Incidental Mutation 'R4179:Adam34'
ID319633
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Namea disintegrin and metallopeptidase domain 34
Synonymstestase 4
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43650309-43710049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43651091 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 506 (M506V)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
Predicted Effect probably benign
Transcript: ENSMUST00000110411
AA Change: M506V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: M506V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212185
AA Change: M506V

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 43652190 missense possibly damaging 0.91
IGL01296:Adam34 APN 8 43651141 missense possibly damaging 0.90
IGL01369:Adam34 APN 8 43651057 missense probably benign 0.00
IGL01933:Adam34 APN 8 43651532 missense probably damaging 1.00
IGL01938:Adam34 APN 8 43651016 missense probably damaging 1.00
IGL02112:Adam34 APN 8 43651138 missense possibly damaging 0.46
IGL02182:Adam34 APN 8 43651753 missense probably benign
IGL02306:Adam34 APN 8 43650485 missense probably benign 0.44
IGL02661:Adam34 APN 8 43651535 missense probably damaging 1.00
IGL02888:Adam34 APN 8 43651573 missense probably damaging 1.00
IGL02979:Adam34 APN 8 43651371 missense probably damaging 1.00
IGL03073:Adam34 APN 8 43650903 missense probably damaging 0.99
BB010:Adam34 UTSW 8 43650874 missense probably damaging 1.00
BB020:Adam34 UTSW 8 43650874 missense probably damaging 1.00
PIT4453001:Adam34 UTSW 8 43651312 missense probably damaging 1.00
R0060:Adam34 UTSW 8 43675883 intron probably benign
R0317:Adam34 UTSW 8 43652251 missense probably benign 0.14
R0322:Adam34 UTSW 8 43651921 missense probably benign 0.00
R0427:Adam34 UTSW 8 43652456 missense probably benign 0.15
R0593:Adam34 UTSW 8 43651687 missense possibly damaging 0.87
R0837:Adam34 UTSW 8 43651500 missense probably benign 0.00
R0927:Adam34 UTSW 8 43651584 missense probably damaging 1.00
R1634:Adam34 UTSW 8 43652090 missense possibly damaging 0.81
R1653:Adam34 UTSW 8 43650645 nonsense probably null
R1826:Adam34 UTSW 8 43651342 missense probably damaging 1.00
R1873:Adam34 UTSW 8 43651806 missense probably benign 0.02
R1943:Adam34 UTSW 8 43650827 missense possibly damaging 0.48
R1943:Adam34 UTSW 8 43651815 missense probably damaging 1.00
R2147:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2150:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2206:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2207:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2268:Adam34 UTSW 8 43650610 missense probably benign 0.00
R2349:Adam34 UTSW 8 43652378 missense probably damaging 0.99
R3983:Adam34 UTSW 8 43650769 missense probably benign
R4158:Adam34 UTSW 8 43650817 missense probably damaging 1.00
R5219:Adam34 UTSW 8 43651424 missense probably benign
R5398:Adam34 UTSW 8 43651241 missense probably damaging 1.00
R5611:Adam34 UTSW 8 43651712 missense probably benign 0.43
R5928:Adam34 UTSW 8 43652030 missense probably benign 0.08
R6115:Adam34 UTSW 8 43652061 missense probably benign
R6319:Adam34 UTSW 8 43651915 missense probably benign 0.01
R6384:Adam34 UTSW 8 43650799 missense probably benign 0.00
R6706:Adam34 UTSW 8 43651442 nonsense probably null
R6992:Adam34 UTSW 8 43652605 start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 43652266 missense probably damaging 1.00
R7151:Adam34 UTSW 8 43651462 missense probably benign 0.19
R7187:Adam34 UTSW 8 43652528 missense probably benign 0.02
R7223:Adam34 UTSW 8 43652004 missense probably benign 0.02
R7487:Adam34 UTSW 8 43651154 missense probably damaging 1.00
R7726:Adam34 UTSW 8 43651171 missense probably damaging 0.99
R7789:Adam34 UTSW 8 43652451 missense probably benign 0.00
R7810:Adam34 UTSW 8 43652008 missense probably benign 0.01
R7933:Adam34 UTSW 8 43650874 missense probably damaging 1.00
R8192:Adam34 UTSW 8 43650933 missense probably damaging 1.00
R8231:Adam34 UTSW 8 43651622 missense probably benign
R8238:Adam34 UTSW 8 43650956 missense probably damaging 1.00
R8259:Adam34 UTSW 8 43651609 missense probably benign 0.03
R8339:Adam34 UTSW 8 43650603 missense probably benign 0.20
R8381:Adam34 UTSW 8 43651810 missense possibly damaging 0.70
R8670:Adam34 UTSW 8 43652089 missense possibly damaging 0.91
R8693:Adam34 UTSW 8 43651604 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATTCTCACACTGAATTCGC -3'
(R):5'- CAGCGACTGTGTTCTCAAACC -3'

Sequencing Primer
(F):5'- TGAATTCGCCCACAGAGTAC -3'
(R):5'- AAACCTGGTGCTCAATGTGC -3'
Posted On2015-06-10