Incidental Mutation 'R4179:Arrdc2'
ID319635
Institutional Source Beutler Lab
Gene Symbol Arrdc2
Ensembl Gene ENSMUSG00000002910
Gene Namearrestin domain containing 2
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70835129-70839720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70837177 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 34 (L34Q)
Ref Sequence ENSEMBL: ENSMUSP00000148405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002989] [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212405]
Predicted Effect probably damaging
Transcript: ENSMUST00000002989
AA Change: L261Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002989
Gene: ENSMUSG00000002910
AA Change: L261Q

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 158 2.9e-43 PFAM
Arrestin_C 180 307 2.14e-28 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110078
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110081
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212405
AA Change: L34Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213095
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Arrdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:Arrdc2 APN 8 70838979 missense probably benign 0.11
R1593:Arrdc2 UTSW 8 70837120 missense probably damaging 1.00
R2918:Arrdc2 UTSW 8 70837527 missense probably benign 0.00
R4825:Arrdc2 UTSW 8 70839277 splice site probably null
R4974:Arrdc2 UTSW 8 70837518 missense probably benign 0.17
R6851:Arrdc2 UTSW 8 70838725 missense probably damaging 1.00
R7827:Arrdc2 UTSW 8 70839394 missense probably damaging 1.00
R8035:Arrdc2 UTSW 8 70839382 missense probably benign 0.19
R8493:Arrdc2 UTSW 8 70836857 critical splice donor site probably null
X0012:Arrdc2 UTSW 8 70837342 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCCACGAAGACCTGAAG -3'
(R):5'- CAGCTGGAATGGGTAATCGG -3'

Sequencing Primer
(F):5'- CCACGAAGACCTGAAGGGAGC -3'
(R):5'- TGTAGGCGAGGTCATCCCTATC -3'
Posted On2015-06-10