Incidental Mutation 'R4179:Cmtr2'
ID319639
Institutional Source Beutler Lab
Gene Symbol Cmtr2
Ensembl Gene ENSMUSG00000046441
Gene Namecap methyltransferase 2
SynonymsFtsjd1, C730036L12Rik
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110215665-110224486 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 110221037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056972] [ENSMUST00000189685]
Predicted Effect probably null
Transcript: ENSMUST00000056972
SMART Domains Protein: ENSMUSP00000060558
Gene: ENSMUSG00000046441

DomainStartEndE-ValueType
Pfam:FtsJ 110 320 1.7e-28 PFAM
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189685
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Cmtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Cmtr2 APN 8 110223100 missense probably benign 0.02
IGL01068:Cmtr2 APN 8 110222869 missense possibly damaging 0.65
IGL01286:Cmtr2 APN 8 110222852 missense possibly damaging 0.95
IGL01916:Cmtr2 APN 8 110221948 missense probably benign 0.01
IGL02302:Cmtr2 APN 8 110221504 missense probably damaging 1.00
IGL02426:Cmtr2 APN 8 110221690 missense possibly damaging 0.65
IGL02903:Cmtr2 APN 8 110222878 missense probably benign 0.02
PIT4362001:Cmtr2 UTSW 8 110222336 missense probably damaging 0.99
R1435:Cmtr2 UTSW 8 110221079 missense probably benign
R1501:Cmtr2 UTSW 8 110221603 missense probably benign 0.29
R1512:Cmtr2 UTSW 8 110222635 missense probably damaging 0.99
R1709:Cmtr2 UTSW 8 110221949 missense probably benign 0.31
R1715:Cmtr2 UTSW 8 110222798 missense probably damaging 1.00
R1953:Cmtr2 UTSW 8 110221919 missense probably damaging 1.00
R1960:Cmtr2 UTSW 8 110221750 missense probably damaging 1.00
R2422:Cmtr2 UTSW 8 110222781 missense probably benign 0.02
R3717:Cmtr2 UTSW 8 110221754 missense probably damaging 0.96
R4043:Cmtr2 UTSW 8 110221830 nonsense probably null
R4074:Cmtr2 UTSW 8 110221217 missense possibly damaging 0.83
R4457:Cmtr2 UTSW 8 110222252 missense probably benign 0.02
R4945:Cmtr2 UTSW 8 110221433 missense probably damaging 0.99
R5371:Cmtr2 UTSW 8 110221412 missense probably damaging 1.00
R6753:Cmtr2 UTSW 8 110222979 missense probably damaging 1.00
R7231:Cmtr2 UTSW 8 110222546 missense probably benign 0.02
R7527:Cmtr2 UTSW 8 110222138 missense probably damaging 1.00
R7580:Cmtr2 UTSW 8 110221677 missense probably damaging 0.99
R7808:Cmtr2 UTSW 8 110221619 missense possibly damaging 0.88
R8510:Cmtr2 UTSW 8 110222435 missense possibly damaging 0.53
R8690:Cmtr2 UTSW 8 110222345 missense probably benign 0.00
Z1177:Cmtr2 UTSW 8 110221499 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTATGCTGAGGACTGATGGC -3'
(R):5'- GTCTAGAAGAGCCCTGAACTCG -3'

Sequencing Primer
(F):5'- CTGAGGACTGATGGCTGTCTAG -3'
(R):5'- AGAGCCCTGAACTCGAGGTG -3'
Posted On2015-06-10