Incidental Mutation 'R4179:Olfr149'
ID319640
Institutional Source Beutler Lab
Gene Symbol Olfr149
Ensembl Gene ENSMUSG00000062121
Gene Nameolfactory receptor 149
SynonymsGA_x6K02T2PVTD-33400306-33399371, MOR224-8, M31
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39700518-39707117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39702091 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 226 (I226T)
Ref Sequence ENSEMBL: ENSMUSP00000149664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082027] [ENSMUST00000215192]
Predicted Effect probably benign
Transcript: ENSMUST00000082027
AA Change: I226T

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080686
Gene: ENSMUSG00000062121
AA Change: I226T

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 223 3.8e-9 PFAM
Pfam:7tm_1 39 286 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215192
AA Change: I226T

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Olfr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr149 APN 9 39702253 missense probably damaging 1.00
IGL02707:Olfr149 APN 9 39702641 missense probably damaging 0.99
IGL02730:Olfr149 APN 9 39702238 missense probably damaging 1.00
IGL03375:Olfr149 APN 9 39702575 missense probably damaging 1.00
R0244:Olfr149 UTSW 9 39702173 missense probably damaging 0.97
R0358:Olfr149 UTSW 9 39702001 missense possibly damaging 0.95
R5120:Olfr149 UTSW 9 39702070 missense probably benign 0.00
R5185:Olfr149 UTSW 9 39701876 missense probably benign
R5818:Olfr149 UTSW 9 39702365 missense probably benign 0.01
R6029:Olfr149 UTSW 9 39702400 missense probably damaging 1.00
R6207:Olfr149 UTSW 9 39702310 missense probably benign 0.06
R6454:Olfr149 UTSW 9 39701834 makesense probably null
R7451:Olfr149 UTSW 9 39702127 missense probably damaging 0.99
R8193:Olfr149 UTSW 9 39702202 missense possibly damaging 0.90
R8263:Olfr149 UTSW 9 39702157 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGACAGTCCACAGTGATGATTTC -3'
(R):5'- TGTGGCCCCAAAGATGTGAAC -3'

Sequencing Primer
(F):5'- GTAAATTAACGGATTTAGCATAGGGG -3'
(R):5'- GTGGCCCCAAAGATGTGAACTATTAC -3'
Posted On2015-06-10