Incidental Mutation 'R4179:Cnot2'
ID319643
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene NameCCR4-NOT transcription complex, subunit 2
Synonyms2810470K03Rik, 2600016M12Rik
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116485161-116581511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116498143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 374 (V374E)
Ref Sequence ENSEMBL: ENSMUSP00000132152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169576] [ENSMUST00000169921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105265
AA Change: V289E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166
AA Change: V289E

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105267
AA Change: V374E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: V374E

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164088
AA Change: V333E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166
AA Change: V333E

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect possibly damaging
Transcript: ENSMUST00000167706
AA Change: V324E

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: V324E

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168036
AA Change: V333E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166
AA Change: V333E

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect possibly damaging
Transcript: ENSMUST00000169921
AA Change: V374E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: V374E

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219544
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116507071 missense probably benign 0.02
IGL02433:Cnot2 APN 10 116492336 missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116499357 missense probably benign 0.15
IGL03383:Cnot2 APN 10 116494817 splice site probably benign
R0145:Cnot2 UTSW 10 116517368 missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116498355 missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116498236 missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116498415 missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116527876 missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116506280 missense probably benign 0.01
R4063:Cnot2 UTSW 10 116537396 missense possibly damaging 0.46
R4196:Cnot2 UTSW 10 116501304 missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116581474 unclassified probably benign
R4572:Cnot2 UTSW 10 116494846 missense probably benign 0.37
R4610:Cnot2 UTSW 10 116499418 missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116506310 splice site probably null
R5847:Cnot2 UTSW 10 116527946 missense probably damaging 0.98
R6444:Cnot2 UTSW 10 116499355 missense probably benign 0.02
R6733:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116537223 intron probably benign
R7139:Cnot2 UTSW 10 116495019 missense probably benign 0.00
R7248:Cnot2 UTSW 10 116498373 missense probably benign 0.05
R7423:Cnot2 UTSW 10 116492398 missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116507080 missense probably benign 0.12
R7851:Cnot2 UTSW 10 116537432 missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116510389 missense probably benign 0.07
R8350:Cnot2 UTSW 10 116486276 missense probably damaging 1.00
R8463:Cnot2 UTSW 10 116517331 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCTACAAGTCTGAGGCTCTC -3'
(R):5'- GGTGGGACTCCATAAATATGTCAG -3'

Sequencing Primer
(F):5'- CTGTGGTGGCACAGGATAC -3'
(R):5'- CCAGGTCGAGTTACTAACATT -3'
Posted On2015-06-10