Incidental Mutation 'R4179:Prkd1'
ID319647
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Nameprotein kinase D1
SynonymsPrkcm, Pkcm, PKD1
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location50341231-50649098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50366448 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 647 (G647C)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
Predicted Effect probably damaging
Transcript: ENSMUST00000002765
AA Change: G647C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: G647C

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50383481 missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50364661 missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50383416 missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50383515 splice site probably benign
IGL01457:Prkd1 APN 12 50392910 nonsense probably null
IGL01538:Prkd1 APN 12 50342142 missense probably benign
IGL01762:Prkd1 APN 12 50387230 missense probably benign 0.00
IGL01876:Prkd1 APN 12 50366348 missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50366379 missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50387263 missense probably benign
IGL02293:Prkd1 APN 12 50489978 missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50364673 missense probably benign 0.09
IGL03309:Prkd1 APN 12 50388424 missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50366356 missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50366372 missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50490041 missense probably benign 0.00
R0899:Prkd1 UTSW 12 50385193 missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50388342 missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50366352 missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50425515 missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50342039 missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50394994 missense probably benign 0.00
R2143:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50648904 missense unknown
R3801:Prkd1 UTSW 12 50383422 missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50419884 splice site probably benign
R3906:Prkd1 UTSW 12 50388426 missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50392941 missense probably benign 0.44
R4510:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50419848 splice site probably null
R4896:Prkd1 UTSW 12 50389962 missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50394622 nonsense probably null
R5263:Prkd1 UTSW 12 50388306 missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50343137 missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50391432 missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50392916 missense probably benign 0.03
R5967:Prkd1 UTSW 12 50364550 missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50388255 missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50366300 critical splice donor site probably null
R6063:Prkd1 UTSW 12 50342043 missense probably benign 0.02
R6309:Prkd1 UTSW 12 50394660 nonsense probably null
R6518:Prkd1 UTSW 12 50425495 missense probably benign 0.08
R6868:Prkd1 UTSW 12 50425537 missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50388342 missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50648834 missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50425517 missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50342016 missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50392892 missense probably benign
R8671:Prkd1 UTSW 12 50388408 missense probably benign 0.00
R8805:Prkd1 UTSW 12 50388372 missense probably benign 0.45
R8805:Prkd1 UTSW 12 50388373 missense probably damaging 0.99
X0024:Prkd1 UTSW 12 50489974 missense probably benign 0.31
X0062:Prkd1 UTSW 12 50394922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAGATCACAAAGCGAGACC -3'
(R):5'- ATATAAGGCGGCACATGTGG -3'

Sequencing Primer
(F):5'- CATCTGATATTGAACACTGGGTG -3'
(R):5'- TATAAGGCGGCACATGTGGAATTTG -3'
Posted On2015-06-10