Incidental Mutation 'R4179:Riok1'
ID319649
Institutional Source Beutler Lab
Gene Symbol Riok1
Ensembl Gene ENSMUSG00000021428
Gene NameRIO kinase 1
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38036995-38061433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38048955 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 216 (F216L)
Ref Sequence ENSEMBL: ENSMUSP00000021866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021866] [ENSMUST00000223656] [ENSMUST00000224477]
Predicted Effect probably damaging
Transcript: ENSMUST00000021866
AA Change: F216L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021866
Gene: ENSMUSG00000021428
AA Change: F216L

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
RIO 150 386 5.1e-134 SMART
Blast:RIO 465 531 4e-12 BLAST
low complexity region 551 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223910
Predicted Effect probably benign
Transcript: ENSMUST00000224477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224683
Predicted Effect unknown
Transcript: ENSMUST00000224956
AA Change: F160L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226056
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Riok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Riok1 APN 13 38059956 missense possibly damaging 0.80
IGL02675:Riok1 APN 13 38050243 missense probably damaging 0.99
IGL02892:Riok1 APN 13 38040065 splice site probably benign
IGL02952:Riok1 APN 13 38048890 missense probably damaging 1.00
IGL03386:Riok1 APN 13 38057237 nonsense probably null
IGL03054:Riok1 UTSW 13 38047315 missense probably damaging 1.00
R0959:Riok1 UTSW 13 38057173 missense probably damaging 0.96
R1423:Riok1 UTSW 13 38049114 missense probably damaging 1.00
R1558:Riok1 UTSW 13 38050855 missense probably damaging 1.00
R1624:Riok1 UTSW 13 38037511 missense probably damaging 1.00
R1717:Riok1 UTSW 13 38052950 missense probably damaging 1.00
R1858:Riok1 UTSW 13 38058718 nonsense probably null
R1920:Riok1 UTSW 13 38057201 missense probably benign 0.27
R2857:Riok1 UTSW 13 38049077 missense probably damaging 1.00
R7052:Riok1 UTSW 13 38037015 unclassified probably benign
R7354:Riok1 UTSW 13 38047312 missense probably benign 0.15
R7689:Riok1 UTSW 13 38045287 missense probably damaging 1.00
R8207:Riok1 UTSW 13 38052320 missense probably damaging 1.00
R8432:Riok1 UTSW 13 38037492 missense probably benign 0.01
Z1176:Riok1 UTSW 13 38058723 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAAGAGAGGATTGTGTCGTC -3'
(R):5'- CGCATTTGTACTACAGACCCTC -3'

Sequencing Primer
(F):5'- CAAGAGAGGATTGTGTCGTCATTTC -3'
(R):5'- AGTTACCTGCACAAATTCCTCATC -3'
Posted On2015-06-10