Incidental Mutation 'R4179:Cdadc1'
ID319653
Institutional Source Beutler Lab
Gene Symbol Cdadc1
Ensembl Gene ENSMUSG00000021982
Gene Namecytidine and dCMP deaminase domain containing 1
Synonyms2310010M10Rik, NYD-SP15
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59559388-59597959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59592486 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 77 (T77N)
Ref Sequence ENSEMBL: ENSMUSP00000153357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022555] [ENSMUST00000056997] [ENSMUST00000167100] [ENSMUST00000171683] [ENSMUST00000225839]
Predicted Effect probably benign
Transcript: ENSMUST00000022555
AA Change: T77N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022555
Gene: ENSMUSG00000021982
AA Change: T77N

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.2e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056997
AA Change: T77N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052233
Gene: ENSMUSG00000021982
AA Change: T77N

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.8e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167100
AA Change: T77N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128022
Gene: ENSMUSG00000021982
AA Change: T77N

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 4.9e-9 PFAM
Pfam:dCMP_cyt_deam_1 317 446 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171683
AA Change: T77N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128064
Gene: ENSMUSG00000021982
AA Change: T77N

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 1.4e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225103
Predicted Effect probably benign
Transcript: ENSMUST00000225839
AA Change: T77N

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Cdadc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cdadc1 APN 14 59581369 missense probably damaging 1.00
IGL01897:Cdadc1 APN 14 59592537 critical splice acceptor site probably null
IGL02648:Cdadc1 APN 14 59586363 missense probably damaging 1.00
IGL02720:Cdadc1 APN 14 59586047 missense probably damaging 1.00
R0254:Cdadc1 UTSW 14 59575907 splice site probably benign
R0470:Cdadc1 UTSW 14 59573841 splice site probably benign
R0554:Cdadc1 UTSW 14 59586452 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586083 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586092 missense probably damaging 1.00
R1649:Cdadc1 UTSW 14 59573793 missense probably damaging 1.00
R1900:Cdadc1 UTSW 14 59586532 missense probably damaging 1.00
R1934:Cdadc1 UTSW 14 59589860 missense possibly damaging 0.91
R1976:Cdadc1 UTSW 14 59573768 missense probably damaging 1.00
R2061:Cdadc1 UTSW 14 59581334 missense probably damaging 1.00
R2136:Cdadc1 UTSW 14 59568044 splice site probably null
R2147:Cdadc1 UTSW 14 59597753 critical splice donor site probably null
R2929:Cdadc1 UTSW 14 59597835 start codon destroyed probably null 0.70
R2991:Cdadc1 UTSW 14 59586072 missense possibly damaging 0.68
R4621:Cdadc1 UTSW 14 59586555 missense probably benign 0.00
R4814:Cdadc1 UTSW 14 59568991 frame shift probably null
R4816:Cdadc1 UTSW 14 59568991 frame shift probably null
R4817:Cdadc1 UTSW 14 59568991 frame shift probably null
R4872:Cdadc1 UTSW 14 59564524 missense probably benign 0.04
R5448:Cdadc1 UTSW 14 59573826 missense possibly damaging 0.94
R5642:Cdadc1 UTSW 14 59589923 missense possibly damaging 0.95
R5732:Cdadc1 UTSW 14 59596911 missense probably damaging 0.99
R6472:Cdadc1 UTSW 14 59586042 missense probably damaging 0.99
R6501:Cdadc1 UTSW 14 59586449 missense probably benign 0.00
R7332:Cdadc1 UTSW 14 59575764 missense possibly damaging 0.63
R7763:Cdadc1 UTSW 14 59573834 missense probably damaging 1.00
X0064:Cdadc1 UTSW 14 59575854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGCATTGCTTAACACATCTG -3'
(R):5'- TAGTACCCAAGCAAAGTGAGAC -3'

Sequencing Primer
(F):5'- CATCTGTGTGAAATCAGGATTAGACG -3'
(R):5'- GACATCACTGCAGAGCTTTG -3'
Posted On2015-06-10