Incidental Mutation 'R4179:Ctsb'
ID319654
Institutional Source Beutler Lab
Gene Symbol Ctsb
Ensembl Gene ENSMUSG00000021939
Gene Namecathepsin B
SynonymsCB
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63122462-63145923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63133452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 38 (N38D)
Ref Sequence ENSEMBL: ENSMUSP00000006235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006235]
Predicted Effect probably benign
Transcript: ENSMUST00000006235
AA Change: N38D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000006235
Gene: ENSMUSG00000021939
AA Change: N38D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Propeptide_C1 26 65 5.4e-22 PFAM
Pept_C1 80 329 1.12e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin B light and heavy chains, which can dimerize to generate the double chain form of the enzyme. This enzyme is a lysosomal cysteine protease with both endopeptidase and exopeptidase activity that may play a role in protein turnover. Homozygous knockout mice for this gene exhibit reduced pancreatic damage following induced pancreatitis and reduced hepatocyte apoptosis in a model of liver injury. Pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are born normal without gross abnormalities. Homozygous mutant has resistance to induced pancreatitis. In combination with Ctsltm1Cptr, double homozygous mutant shows postnatal lethality due to wide neuronal degeneration in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Ctsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ctsb APN 14 63135650 missense probably damaging 0.99
IGL02565:Ctsb APN 14 63138410 missense probably null 1.00
IGL03011:Ctsb APN 14 63133357 missense probably benign 0.13
R0001:Ctsb UTSW 14 63135622 missense probably benign 0.00
R1226:Ctsb UTSW 14 63141740 missense probably damaging 1.00
R1241:Ctsb UTSW 14 63139104 missense probably benign 0.28
R1533:Ctsb UTSW 14 63139095 missense probably damaging 1.00
R6042:Ctsb UTSW 14 63141856 missense probably damaging 1.00
R6396:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7422:Ctsb UTSW 14 63142303 missense probably benign 0.00
R7472:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7573:Ctsb UTSW 14 63138101 missense probably benign 0.04
R7721:Ctsb UTSW 14 63133316 splice site probably benign
R8498:Ctsb UTSW 14 63133432 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTCACAGTGAGGCCAGAAAGG -3'
(R):5'- TGCACACAACATGGAGACTG -3'

Sequencing Primer
(F):5'- AGTCATGCCCGTGTGTAGAAATC -3'
(R):5'- TGGAGAGCAATCCATGGTGTG -3'
Posted On2015-06-10