Incidental Mutation 'R4179:Pcdha2'
ID319664
Institutional Source Beutler Lab
Gene Symbol Pcdha2
Ensembl Gene ENSMUSG00000104148
Gene Nameprotocadherin alpha 2
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36939205-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36941476 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 720 (L720Q)
Ref Sequence ENSEMBL: ENSMUSP00000141355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115662] [ENSMUST00000192503] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115662
AA Change: L720Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148
AA Change: L720Q

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195590
AA Change: L720Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148
AA Change: L720Q

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Pcdha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03052:Pcdha2 UTSW 18 36941617 missense probably damaging 1.00
R3157:Pcdha2 UTSW 18 36940092 missense probably damaging 1.00
R3159:Pcdha2 UTSW 18 36941197 missense probably damaging 1.00
R3806:Pcdha2 UTSW 18 36939529 missense probably benign 0.02
R3806:Pcdha2 UTSW 18 36941691 nonsense probably null
R3815:Pcdha2 UTSW 18 36941695 missense probably benign
R3816:Pcdha2 UTSW 18 36941695 missense probably benign
R3937:Pcdha2 UTSW 18 36941323 missense probably benign 0.42
R3970:Pcdha2 UTSW 18 36940697 nonsense probably null
R4058:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4059:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4457:Pcdha2 UTSW 18 36940546 missense probably damaging 1.00
R4724:Pcdha2 UTSW 18 36940515 missense possibly damaging 0.88
R4812:Pcdha2 UTSW 18 36939808 missense probably benign
R4884:Pcdha2 UTSW 18 36940900 missense probably damaging 1.00
R5130:Pcdha2 UTSW 18 36940669 missense probably damaging 1.00
R5223:Pcdha2 UTSW 18 36940791 missense probably damaging 1.00
R5442:Pcdha2 UTSW 18 36939862 missense probably benign 0.14
R5460:Pcdha2 UTSW 18 36939421 missense probably damaging 1.00
R5493:Pcdha2 UTSW 18 36939509 missense probably damaging 0.98
R5946:Pcdha2 UTSW 18 36941106 missense probably damaging 0.96
R6054:Pcdha2 UTSW 18 36940804 missense probably damaging 1.00
R7378:Pcdha2 UTSW 18 36939385 missense possibly damaging 0.88
R7465:Pcdha2 UTSW 18 36940330 missense probably damaging 1.00
R7542:Pcdha2 UTSW 18 36940089 missense probably damaging 0.99
R7774:Pcdha2 UTSW 18 36941526 missense probably benign
R7953:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8043:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8048:Pcdha2 UTSW 18 36939460 missense probably damaging 1.00
R8371:Pcdha2 UTSW 18 36940263 missense possibly damaging 0.84
R8414:Pcdha2 UTSW 18 36941566 missense probably damaging 1.00
R8472:Pcdha2 UTSW 18 36941272 missense probably damaging 1.00
Z1088:Pcdha2 UTSW 18 36941121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCCACAGTGTTAGTTTCTC -3'
(R):5'- AGTATTCGGCCTCTAAGGGTG -3'

Sequencing Primer
(F):5'- CTCTAGTTGAGAATAGTCAAGCTCC -3'
(R):5'- ATTCCGGACCTTGGGATAGGC -3'
Posted On2015-06-10