Incidental Mutation 'R4179:Idh3g'
ID319668
Institutional Source Beutler Lab
Gene Symbol Idh3g
Ensembl Gene ENSMUSG00000002010
Gene Nameisocitrate dehydrogenase 3 (NAD+), gamma
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R4179 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location73778963-73786897 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 73782004 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002081] [ENSMUST00000052761] [ENSMUST00000052761]
Predicted Effect probably benign
Transcript: ENSMUST00000002081
SMART Domains Protein: ENSMUSP00000002081
Gene: ENSMUSG00000002007

DomainStartEndE-ValueType
low complexity region 6 31 N/A INTRINSIC
Pfam:Pkinase 78 228 1.4e-22 PFAM
Pfam:Pkinase_Tyr 78 230 1.1e-9 PFAM
coiled coil region 260 300 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 341 360 N/A INTRINSIC
Pfam:Pkinase 385 563 2.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052761
SMART Domains Protein: ENSMUSP00000056502
Gene: ENSMUSG00000002010

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Iso_dh 56 379 1.1e-141 SMART
Predicted Effect probably null
Transcript: ENSMUST00000052761
SMART Domains Protein: ENSMUSP00000056502
Gene: ENSMUSG00000002010

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
Iso_dh 56 379 1.1e-141 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156299
Meta Mutation Damage Score 0.9710 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Idh3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Idh3g APN X 73780062 missense probably damaging 0.99
R4180:Idh3g UTSW X 73782004 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCCTAGAGCCTTCCACAC -3'
(R):5'- ATGCTGATAAGGAGCCCCAG -3'

Sequencing Primer
(F):5'- ACCCCCTCCTGAAATCTATACC -3'
(R):5'- GCAATTCTGCCTTGGCTG -3'
Posted On2015-06-10