Mutagenetix > Incidental Mutations

Incidental Mutation 'R4180:Col19a1'

319669

Institutional Source

Beutler Lab

Gene Symbol

Col19a1

Ensembl Gene

ENSMUSG00000026141

Gene Name

collagen, type XIX, alpha 1

Synonyms

MMRRC Submission

041016-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4180 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

24261890-24587472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24270392 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 1060 (G1060E)

Ref Sequence

ENSEMBL: ENSMUSP00000110899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115244]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115244
AA Change: G1060E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: G1060E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TSPN	47	231	1.61e-63	SMART
low complexity region	254	266	N/A	INTRINSIC
Pfam:Collagen	288	347	3.1e-9	PFAM
Pfam:Collagen	330	391	1.1e-9	PFAM
internal_repeat_4	455	492	1.88e-5	PROSPERO
Pfam:Collagen	519	579	2e-9	PFAM
Pfam:Collagen	559	620	4.9e-8	PFAM
Pfam:Collagen	619	675	3.5e-10	PFAM
low complexity region	723	741	N/A	INTRINSIC
Pfam:Collagen	753	819	2.8e-9	PFAM
Pfam:Collagen	831	892	3.9e-11	PFAM
internal_repeat_2	905	943	1.18e-11	PROSPERO
internal_repeat_1	905	980	8.89e-27	PROSPERO
internal_repeat_2	947	982	1.18e-11	PROSPERO
low complexity region	983	1003	N/A	INTRINSIC
low complexity region	1048	1069	N/A	INTRINSIC
low complexity region	1078	1115	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144297

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (52/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,441,578	S1326P	possibly damaging	Het
Adam22	T	G	5: 8,149,218	D246A	probably damaging	Het
Bmf	T	C	2: 118,532,537		probably benign	Het
Cd300lf	T	C	11: 115,124,263	Y160C	possibly damaging	Het
Chuk	G	A	19: 44,101,840	A71V	probably benign	Het
Dock7	A	G	4: 99,016,736	V634A	probably benign	Het
Dpm3	A	G	3: 89,266,732		probably benign	Het
Dqx1	A	G	6: 83,059,479	T155A	probably benign	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Fam184b	T	C	5: 45,539,764	E686G	probably benign	Het
Fhad1	T	A	4: 141,985,543	D195V	possibly damaging	Het
Glis2	T	C	16: 4,611,376	S148P	probably benign	Het
Gm8587	C	T	12: 88,089,746		noncoding transcript	Het
Gon7	A	G	12: 102,754,104	S90P	probably benign	Het
Haus6	A	T	4: 86,583,574	W687R	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Idh3g	A	T	X: 73,782,004		probably null	Het
Ints9	T	C	14: 64,992,981	L119P	probably damaging	Het
Itga9	T	C	9: 118,607,078	Y51H	probably damaging	Het
Klf17	T	A	4: 117,759,186	H316L	probably benign	Het
Klf4	C	T	4: 55,530,884	G26R	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lhcgr	A	G	17: 88,742,283	V605A	probably damaging	Het
Mafa	T	C	15: 75,747,564	Y120C	possibly damaging	Het
Map3k20	A	G	2: 72,441,571	Y681C	probably damaging	Het
Nub1	T	C	5: 24,692,877	I87T	probably damaging	Het
Olfr356	T	A	2: 36,937,230	V37D	probably damaging	Het
Pak2	C	G	16: 32,052,187	G59A	probably benign	Het
Pdzrn4	T	A	15: 92,402,017	V256D	possibly damaging	Het
Pkd2l1	T	C	19: 44,192,181	N32D	probably benign	Het
Plec	T	C	15: 76,180,215	K1953R	possibly damaging	Het
Plekhg4	T	A	8: 105,381,398	V1029E	possibly damaging	Het
Prkcd	A	G	14: 30,610,304		probably benign	Het
Rgcc	T	C	14: 79,300,715	S79G	probably benign	Het
Sspo	T	C	6: 48,498,395		probably null	Het
Stxbp5l	A	T	16: 37,247,880	C315S	probably benign	Het
Tc2n	A	G	12: 101,665,695	L301P	probably damaging	Het
Tcerg1l	T	C	7: 138,276,676		probably null	Het
Tex12	T	C	9: 50,559,287		probably null	Het
Tgm5	T	C	2: 121,076,961	I94V	probably benign	Het
Tonsl	A	G	15: 76,624,475	L26P	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trbv4	A	C	6: 41,059,712	D57A	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tuba4a	T	C	1: 75,215,782	D396G	probably benign	Het
Txnrd2	C	G	16: 18,426,425		probably null	Het
Zfp445	T	C	9: 122,852,524	N784S	probably benign	Het
Zfp459	G	T	13: 67,408,443	L174I	probably benign	Het

Other mutations in Col19a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Col19a1	APN	1	24561306	missense	unknown
IGL00514:Col19a1	APN	1	24536932	missense	unknown
IGL00756:Col19a1	APN	1	24322942	missense	possibly damaging	0.85
IGL01408:Col19a1	APN	1	24306250	splice site	probably benign
IGL01608:Col19a1	APN	1	24282545	missense	probably damaging	1.00
IGL01664:Col19a1	APN	1	24561335	missense	unknown
IGL01906:Col19a1	APN	1	24317429	missense	probably damaging	1.00
IGL01916:Col19a1	APN	1	24534241	missense	unknown
IGL02040:Col19a1	APN	1	24312045	critical splice donor site	probably null
IGL02407:Col19a1	APN	1	24312372	splice site	probably null
IGL02505:Col19a1	APN	1	24300584	splice site	probably benign
IGL02606:Col19a1	APN	1	24534116	nonsense	probably null
IGL02659:Col19a1	APN	1	24534034	missense	unknown
IGL02815:Col19a1	APN	1	24285251	splice site	probably null
IGL02880:Col19a1	APN	1	24325973	splice site	probably benign
IGL02897:Col19a1	APN	1	24534098	missense	unknown
IGL03102:Col19a1	APN	1	24328053	missense	probably damaging	1.00
R0038:Col19a1	UTSW	1	24559744	missense	unknown
R0109:Col19a1	UTSW	1	24559768	splice site	probably null
R0124:Col19a1	UTSW	1	24526458	missense	unknown
R0326:Col19a1	UTSW	1	24285051	critical splice donor site	probably null
R0390:Col19a1	UTSW	1	24289655	splice site	probably benign
R0675:Col19a1	UTSW	1	24575455	start gained	probably benign
R0826:Col19a1	UTSW	1	24526386	missense	unknown
R0948:Col19a1	UTSW	1	24296801	missense	probably damaging	0.98
R1014:Col19a1	UTSW	1	24301273	critical splice donor site	probably null
R1619:Col19a1	UTSW	1	24534091	missense	unknown
R1691:Col19a1	UTSW	1	24536941	missense	unknown
R1878:Col19a1	UTSW	1	24317395	missense	probably benign	0.40
R1901:Col19a1	UTSW	1	24536997	missense	unknown
R1928:Col19a1	UTSW	1	24451754	splice site	probably benign
R1940:Col19a1	UTSW	1	24264750	nonsense	probably null
R2015:Col19a1	UTSW	1	24559753	missense	unknown
R2571:Col19a1	UTSW	1	24374631	missense	unknown
R2844:Col19a1	UTSW	1	24559681	missense	unknown
R2845:Col19a1	UTSW	1	24559681	missense	unknown
R3107:Col19a1	UTSW	1	24337936	missense	possibly damaging	0.71
R3861:Col19a1	UTSW	1	24326017	missense	probably damaging	1.00
R3872:Col19a1	UTSW	1	24575327	splice site	probably benign
R4195:Col19a1	UTSW	1	24534052	missense	unknown
R4196:Col19a1	UTSW	1	24534052	missense	unknown
R4234:Col19a1	UTSW	1	24315395	splice site	probably null
R4250:Col19a1	UTSW	1	24525645	missense	unknown
R4396:Col19a1	UTSW	1	24510866	missense	unknown
R4405:Col19a1	UTSW	1	24534109	missense	unknown
R4450:Col19a1	UTSW	1	24322035	missense	probably damaging	0.96
R4583:Col19a1	UTSW	1	24561329	missense	unknown
R4980:Col19a1	UTSW	1	24526483	missense	unknown
R5222:Col19a1	UTSW	1	24559640	splice site	probably null
R5407:Col19a1	UTSW	1	24303494	missense	probably damaging	0.99
R5439:Col19a1	UTSW	1	24293112	missense	probably damaging	1.00
R5739:Col19a1	UTSW	1	24337915	missense	probably damaging	1.00
R5740:Col19a1	UTSW	1	24337915	missense	probably damaging	1.00
R5891:Col19a1	UTSW	1	24289725	missense	probably damaging	1.00
R5996:Col19a1	UTSW	1	24328071	missense	probably damaging	1.00
R6074:Col19a1	UTSW	1	24526483	missense	unknown
R6152:Col19a1	UTSW	1	24374621	missense	unknown
R6191:Col19a1	UTSW	1	24317393	missense	probably damaging	1.00
R6236:Col19a1	UTSW	1	24279949	missense	probably damaging	1.00
R6315:Col19a1	UTSW	1	24526452	missense	unknown
R6709:Col19a1	UTSW	1	24282496	missense	probably damaging	1.00
R6748:Col19a1	UTSW	1	24534070	missense	unknown
R7098:Col19a1	UTSW	1	24526474	missense	unknown
R7114:Col19a1	UTSW	1	24337936	missense	possibly damaging	0.71
R7292:Col19a1	UTSW	1	24530008	missense	unknown
R7392:Col19a1	UTSW	1	24534034	missense	unknown
R7478:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7480:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7481:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7512:Col19a1	UTSW	1	24317707	missense	probably damaging	1.00
R7618:Col19a1	UTSW	1	24322084	missense	probably benign	0.07
R7698:Col19a1	UTSW	1	24312078	missense	probably benign	0.09
R7711:Col19a1	UTSW	1	24530008	missense	unknown
R7725:Col19a1	UTSW	1	24270444	missense	possibly damaging	0.94
Z1088:Col19a1	UTSW	1	24279940	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGTGACAATGACAGAGAAGC -3'
(R):5'- GCAGACCAGTTGATATAGAATATGTGC -3'

Sequencing Primer
(F):5'- AGCAGACAGTATTATGGTTACTCTGG -3'
(R):5'- CTTTGTGTTAAAAGGTTTGGAAATGC -3'

Posted On

2015-06-10