Incidental Mutation 'R0395:Per1'
ID31968
Institutional Source Beutler Lab
Gene Symbol Per1
Ensembl Gene ENSMUSG00000020893
Gene Nameperiod circadian clock 1
SynonymsmPer1, m-rigui
MMRRC Submission 038601-MU
Accession Numbers

Genbank: NM_011065; MGI:1098283

Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R0395 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69095217-69109960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69102277 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 340 (I340N)
Ref Sequence ENSEMBL: ENSMUSP00000098566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021271] [ENSMUST00000101004] [ENSMUST00000102605] [ENSMUST00000132462] [ENSMUST00000142392] [ENSMUST00000166748]
Predicted Effect probably damaging
Transcript: ENSMUST00000021271
AA Change: I340N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021271
Gene: ENSMUSG00000020893
AA Change: I340N

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1222 1.5e-78 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101004
AA Change: I340N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098566
Gene: ENSMUSG00000020893
AA Change: I340N

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102605
AA Change: I320N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099665
Gene: ENSMUSG00000020893
AA Change: I320N

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Blast:PAS 203 255 1e-23 BLAST
PAS 328 394 1.12e-4 SMART
PAC 402 445 1.6e0 SMART
low complexity region 453 461 N/A INTRINSIC
low complexity region 493 523 N/A INTRINSIC
low complexity region 551 558 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 727 752 N/A INTRINSIC
low complexity region 774 788 N/A INTRINSIC
low complexity region 797 824 N/A INTRINSIC
low complexity region 832 857 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
low complexity region 925 952 N/A INTRINSIC
low complexity region 976 993 N/A INTRINSIC
Pfam:Period_C 1011 1210 7.5e-75 PFAM
low complexity region 1250 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132462
SMART Domains Protein: ENSMUSP00000122164
Gene: ENSMUSG00000020893

DomainStartEndE-ValueType
low complexity region 48 81 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142392
AA Change: I340N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121713
Gene: ENSMUSG00000020893
AA Change: I340N

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166748
AA Change: I340N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132635
Gene: ENSMUSG00000020893
AA Change: I340N

DomainStartEndE-ValueType
low complexity region 48 115 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
PAS 208 275 4.19e0 SMART
PAS 348 414 1.12e-4 SMART
PAC 422 465 1.6e0 SMART
low complexity region 473 481 N/A INTRINSIC
low complexity region 513 543 N/A INTRINSIC
low complexity region 571 578 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
low complexity region 747 772 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 852 877 N/A INTRINSIC
low complexity region 890 901 N/A INTRINSIC
low complexity region 945 972 N/A INTRINSIC
low complexity region 996 1013 N/A INTRINSIC
Pfam:Period_C 1031 1230 5.2e-75 PFAM
low complexity region 1270 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.6774 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display a persistent circadian rhythm, but they have a shorter period and their ability to maintain the precision and the stability of the period is impaired. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(3) Gene trapped(5)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Acsm2 G A 7: 119,575,746 D245N probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apba2 T A 7: 64,743,408 I547N probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Col16a1 G A 4: 130,073,109 G583D probably damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Mast4 T C 13: 102,735,273 E2529G probably damaging Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Slf1 A G 13: 77,105,969 probably benign Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Per1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Per1 APN 11 69104199 missense probably damaging 1.00
IGL01907:Per1 APN 11 69105599 missense probably benign 0.00
IGL02078:Per1 APN 11 69104299 missense probably damaging 1.00
IGL02296:Per1 APN 11 69102175 missense probably damaging 1.00
IGL02677:Per1 APN 11 69106660 missense probably benign 0.07
0152:Per1 UTSW 11 69104022 splice site probably benign
IGL03048:Per1 UTSW 11 69104726 missense probably damaging 0.99
P0043:Per1 UTSW 11 69102043 splice site probably benign
R0089:Per1 UTSW 11 69104043 missense probably benign 0.27
R0116:Per1 UTSW 11 69101880 splice site probably benign
R0531:Per1 UTSW 11 69104190 missense probably damaging 1.00
R0681:Per1 UTSW 11 69101201 missense probably damaging 1.00
R0788:Per1 UTSW 11 69101359 splice site probably benign
R1233:Per1 UTSW 11 69102211 missense probably damaging 1.00
R1554:Per1 UTSW 11 69103627 missense probably damaging 1.00
R3793:Per1 UTSW 11 69109301 missense probably benign 0.30
R4706:Per1 UTSW 11 69100618 start gained probably benign
R4716:Per1 UTSW 11 69101231 missense probably damaging 1.00
R4965:Per1 UTSW 11 69104401 missense probably benign 0.06
R5111:Per1 UTSW 11 69100786 missense probably damaging 1.00
R5270:Per1 UTSW 11 69103598 missense probably benign
R5583:Per1 UTSW 11 69103445 missense probably damaging 1.00
R5588:Per1 UTSW 11 69107627 missense probably damaging 1.00
R6184:Per1 UTSW 11 69102904 missense probably damaging 1.00
R6430:Per1 UTSW 11 69104296 missense probably damaging 1.00
R6819:Per1 UTSW 11 69101458 missense probably damaging 1.00
R6911:Per1 UTSW 11 69103257 missense probably damaging 1.00
R7158:Per1 UTSW 11 69104104 unclassified probably benign
R7340:Per1 UTSW 11 69103182 missense probably damaging 1.00
R7438:Per1 UTSW 11 69104735 missense possibly damaging 0.79
R7513:Per1 UTSW 11 69105571 missense probably benign 0.00
R7555:Per1 UTSW 11 69106513 missense probably damaging 1.00
X0023:Per1 UTSW 11 69103124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAAAGTCTGTCTTCTGCCG -3'
(R):5'- TTGTCACAGCTCAGGGACCTCATC -3'

Sequencing Primer
(F):5'- CTTCTGCCGAATCAGGTAAGG -3'
(R):5'- AACCCTACCTCGGAGCAGG -3'
Posted On2013-04-24