Incidental Mutation 'R4180:Tex12'
ID319691
Institutional Source Beutler Lab
Gene Symbol Tex12
Ensembl Gene ENSMUSG00000032065
Gene Nametestis expressed gene 12
Synonyms
MMRRC Submission 041016-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4180 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50556819-50561325 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 50559287 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034568] [ENSMUST00000119103] [ENSMUST00000213916] [ENSMUST00000217236]
Predicted Effect probably benign
Transcript: ENSMUST00000034568
SMART Domains Protein: ENSMUSP00000034568
Gene: ENSMUSG00000032065

DomainStartEndE-ValueType
Pfam:TEX12 28 122 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119103
SMART Domains Protein: ENSMUSP00000112727
Gene: ENSMUSG00000032066

DomainStartEndE-ValueType
Pfam:RPE65 14 531 1.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213916
Predicted Effect probably null
Transcript: ENSMUST00000217236
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that is expressed in the testis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit infertility associated with failure of crossover events during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,441,578 S1326P possibly damaging Het
Adam22 T G 5: 8,149,218 D246A probably damaging Het
Bmf T C 2: 118,532,537 probably benign Het
Cd300lf T C 11: 115,124,263 Y160C possibly damaging Het
Chuk G A 19: 44,101,840 A71V probably benign Het
Col19a1 C T 1: 24,270,392 G1060E probably damaging Het
Dock7 A G 4: 99,016,736 V634A probably benign Het
Dpm3 A G 3: 89,266,732 probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fam184b T C 5: 45,539,764 E686G probably benign Het
Fhad1 T A 4: 141,985,543 D195V possibly damaging Het
Glis2 T C 16: 4,611,376 S148P probably benign Het
Gm8587 C T 12: 88,089,746 noncoding transcript Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Haus6 A T 4: 86,583,574 W687R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Ints9 T C 14: 64,992,981 L119P probably damaging Het
Itga9 T C 9: 118,607,078 Y51H probably damaging Het
Klf17 T A 4: 117,759,186 H316L probably benign Het
Klf4 C T 4: 55,530,884 G26R possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lhcgr A G 17: 88,742,283 V605A probably damaging Het
Mafa T C 15: 75,747,564 Y120C possibly damaging Het
Map3k20 A G 2: 72,441,571 Y681C probably damaging Het
Nub1 T C 5: 24,692,877 I87T probably damaging Het
Olfr356 T A 2: 36,937,230 V37D probably damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pdzrn4 T A 15: 92,402,017 V256D possibly damaging Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkcd A G 14: 30,610,304 probably benign Het
Rgcc T C 14: 79,300,715 S79G probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Stxbp5l A T 16: 37,247,880 C315S probably benign Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tcerg1l T C 7: 138,276,676 probably null Het
Tgm5 T C 2: 121,076,961 I94V probably benign Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trbv4 A C 6: 41,059,712 D57A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tuba4a T C 1: 75,215,782 D396G probably benign Het
Txnrd2 C G 16: 18,426,425 probably null Het
Zfp445 T C 9: 122,852,524 N784S probably benign Het
Zfp459 G T 13: 67,408,443 L174I probably benign Het
Other mutations in Tex12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4179:Tex12 UTSW 9 50559287 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGATCAACATAGTTCCTGCTAGG -3'
(R):5'- CCCAGAGGGTGTTTGAACAAAG -3'

Sequencing Primer
(F):5'- GGACAATCCTACCTCTGAGGC -3'
(R):5'- TGTTTGAACAAAGAGTTTTGAGAGG -3'
Posted On2015-06-10