Incidental Mutation 'R4180:Zfp445'
ID319693
Institutional Source Beutler Lab
Gene Symbol Zfp445
Ensembl Gene ENSMUSG00000047036
Gene Namezinc finger protein 445
SynonymsZNF168
MMRRC Submission 041016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R4180 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122844529-122866006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122852524 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 784 (N784S)
Ref Sequence ENSEMBL: ENSMUSP00000151198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056467] [ENSMUST00000213971] [ENSMUST00000214626] [ENSMUST00000216063]
Predicted Effect probably benign
Transcript: ENSMUST00000056467
AA Change: N784S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055738
Gene: ENSMUSG00000047036
AA Change: N784S

DomainStartEndE-ValueType
SCAN 48 160 1.07e-59 SMART
KRAB 219 278 6.74e-30 SMART
low complexity region 320 334 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
ZnF_C2H2 470 492 2.09e-3 SMART
ZnF_C2H2 498 520 3.16e-3 SMART
ZnF_C2H2 553 575 1.41e0 SMART
ZnF_C2H2 581 603 1.04e-3 SMART
ZnF_C2H2 634 656 1.6e-4 SMART
ZnF_C2H2 662 686 6.78e-3 SMART
ZnF_C2H2 718 740 1.67e-2 SMART
ZnF_C2H2 746 768 1.2e-3 SMART
ZnF_C2H2 796 818 2.02e-1 SMART
ZnF_C2H2 824 846 2.95e-3 SMART
ZnF_C2H2 933 955 2.49e-1 SMART
ZnF_C2H2 961 983 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213573
Predicted Effect probably benign
Transcript: ENSMUST00000213971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214162
Predicted Effect probably benign
Transcript: ENSMUST00000214626
Predicted Effect probably benign
Transcript: ENSMUST00000216063
AA Change: N784S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216243
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,441,578 S1326P possibly damaging Het
Adam22 T G 5: 8,149,218 D246A probably damaging Het
Bmf T C 2: 118,532,537 probably benign Het
Cd300lf T C 11: 115,124,263 Y160C possibly damaging Het
Chuk G A 19: 44,101,840 A71V probably benign Het
Col19a1 C T 1: 24,270,392 G1060E probably damaging Het
Dock7 A G 4: 99,016,736 V634A probably benign Het
Dpm3 A G 3: 89,266,732 probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fam184b T C 5: 45,539,764 E686G probably benign Het
Fhad1 T A 4: 141,985,543 D195V possibly damaging Het
Glis2 T C 16: 4,611,376 S148P probably benign Het
Gm8587 C T 12: 88,089,746 noncoding transcript Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Haus6 A T 4: 86,583,574 W687R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Ints9 T C 14: 64,992,981 L119P probably damaging Het
Itga9 T C 9: 118,607,078 Y51H probably damaging Het
Klf17 T A 4: 117,759,186 H316L probably benign Het
Klf4 C T 4: 55,530,884 G26R possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lhcgr A G 17: 88,742,283 V605A probably damaging Het
Mafa T C 15: 75,747,564 Y120C possibly damaging Het
Map3k20 A G 2: 72,441,571 Y681C probably damaging Het
Nub1 T C 5: 24,692,877 I87T probably damaging Het
Olfr356 T A 2: 36,937,230 V37D probably damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pdzrn4 T A 15: 92,402,017 V256D possibly damaging Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkcd A G 14: 30,610,304 probably benign Het
Rgcc T C 14: 79,300,715 S79G probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Stxbp5l A T 16: 37,247,880 C315S probably benign Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tcerg1l T C 7: 138,276,676 probably null Het
Tex12 T C 9: 50,559,287 probably null Het
Tgm5 T C 2: 121,076,961 I94V probably benign Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trbv4 A C 6: 41,059,712 D57A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tuba4a T C 1: 75,215,782 D396G probably benign Het
Txnrd2 C G 16: 18,426,425 probably null Het
Zfp459 G T 13: 67,408,443 L174I probably benign Het
Other mutations in Zfp445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Zfp445 APN 9 122852230 missense probably benign 0.02
IGL02608:Zfp445 APN 9 122861875 missense probably damaging 0.98
IGL03216:Zfp445 APN 9 122851978 missense probably damaging 0.99
IGL03218:Zfp445 APN 9 122857529 missense probably benign 0.00
Nonpareil UTSW 9 122852345 missense probably benign 0.02
R0080:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0082:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0453:Zfp445 UTSW 9 122853513 missense possibly damaging 0.92
R0610:Zfp445 UTSW 9 122852981 missense probably benign 0.44
R0730:Zfp445 UTSW 9 122861758 missense probably damaging 1.00
R1622:Zfp445 UTSW 9 122852549 missense possibly damaging 0.90
R1719:Zfp445 UTSW 9 122852642 missense probably damaging 1.00
R2108:Zfp445 UTSW 9 122852240 missense probably benign 0.13
R2117:Zfp445 UTSW 9 122853437 nonsense probably null
R2143:Zfp445 UTSW 9 122853482 missense possibly damaging 0.70
R2162:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R3620:Zfp445 UTSW 9 122852768 missense probably benign
R3621:Zfp445 UTSW 9 122852768 missense probably benign
R3745:Zfp445 UTSW 9 122854726 missense probably benign 0.00
R3829:Zfp445 UTSW 9 122853077 missense probably benign
R3831:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R4172:Zfp445 UTSW 9 122851937 missense probably benign 0.01
R4747:Zfp445 UTSW 9 122857150 missense possibly damaging 0.81
R4923:Zfp445 UTSW 9 122852293 missense probably benign
R5010:Zfp445 UTSW 9 122852345 missense probably benign 0.02
R5578:Zfp445 UTSW 9 122853337 missense probably benign 0.00
R5759:Zfp445 UTSW 9 122853146 missense probably benign 0.00
R5864:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5865:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5987:Zfp445 UTSW 9 122853886 missense probably benign
R6481:Zfp445 UTSW 9 122857566 missense probably benign 0.00
R6738:Zfp445 UTSW 9 122862058 missense probably damaging 0.96
R6917:Zfp445 UTSW 9 122862294 intron probably null
R7137:Zfp445 UTSW 9 122854778 missense probably damaging 1.00
R7224:Zfp445 UTSW 9 122852143 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATCTTTATCACGCCACTGTGG -3'
(R):5'- GGCAAAGCCTTTCACAATCGC -3'

Sequencing Primer
(F):5'- GATCCTCTGGTGATTAACAAGTCG -3'
(R):5'- AAAGCCTTTCACAATCGCTCATTTC -3'
Posted On2015-06-10