Incidental Mutation 'R4180:Prkcd'
ID319701
Institutional Source Beutler Lab
Gene Symbol Prkcd
Ensembl Gene ENSMUSG00000021948
Gene Nameprotein kinase C, delta
SynonymsPkcd, D14Ertd420e, PKC[d], PKCdelta
MMRRC Submission 041016-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R4180 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30595354-30626210 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 30610304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022521] [ENSMUST00000112202] [ENSMUST00000112203] [ENSMUST00000112206] [ENSMUST00000112207] [ENSMUST00000112210] [ENSMUST00000112211]
Predicted Effect probably benign
Transcript: ENSMUST00000022521
SMART Domains Protein: ENSMUSP00000022521
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112202
SMART Domains Protein: ENSMUSP00000107821
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112203
SMART Domains Protein: ENSMUSP00000107822
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112206
SMART Domains Protein: ENSMUSP00000107825
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 258 512 1.17e-97 SMART
S_TK_X 513 576 8.92e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112207
SMART Domains Protein: ENSMUSP00000107826
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C1 44 93 1.38e-13 SMART
C1 116 165 3.19e-18 SMART
S_TKc 232 486 1.17e-97 SMART
S_TK_X 487 550 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112208
SMART Domains Protein: ENSMUSP00000107827
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112210
SMART Domains Protein: ENSMUSP00000107829
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 347 601 1.17e-97 SMART
S_TK_X 602 665 8.92e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112211
SMART Domains Protein: ENSMUSP00000107830
Gene: ENSMUSG00000021948

DomainStartEndE-ValueType
C2 11 100 1.28e0 SMART
C1 159 208 1.38e-13 SMART
C1 231 280 3.19e-18 SMART
S_TKc 373 627 1.17e-97 SMART
S_TK_X 628 691 8.92e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227078
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased neutrophil cell numbers and activity, increased B cell numbers and proliferation, increased acute inflammation, and increased IgG1 and IgA serum levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,441,578 S1326P possibly damaging Het
Adam22 T G 5: 8,149,218 D246A probably damaging Het
Bmf T C 2: 118,532,537 probably benign Het
Cd300lf T C 11: 115,124,263 Y160C possibly damaging Het
Chuk G A 19: 44,101,840 A71V probably benign Het
Col19a1 C T 1: 24,270,392 G1060E probably damaging Het
Dock7 A G 4: 99,016,736 V634A probably benign Het
Dpm3 A G 3: 89,266,732 probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fam184b T C 5: 45,539,764 E686G probably benign Het
Fhad1 T A 4: 141,985,543 D195V possibly damaging Het
Glis2 T C 16: 4,611,376 S148P probably benign Het
Gm8587 C T 12: 88,089,746 noncoding transcript Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Haus6 A T 4: 86,583,574 W687R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Ints9 T C 14: 64,992,981 L119P probably damaging Het
Itga9 T C 9: 118,607,078 Y51H probably damaging Het
Klf17 T A 4: 117,759,186 H316L probably benign Het
Klf4 C T 4: 55,530,884 G26R possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lhcgr A G 17: 88,742,283 V605A probably damaging Het
Mafa T C 15: 75,747,564 Y120C possibly damaging Het
Map3k20 A G 2: 72,441,571 Y681C probably damaging Het
Nub1 T C 5: 24,692,877 I87T probably damaging Het
Olfr356 T A 2: 36,937,230 V37D probably damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pdzrn4 T A 15: 92,402,017 V256D possibly damaging Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Rgcc T C 14: 79,300,715 S79G probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Stxbp5l A T 16: 37,247,880 C315S probably benign Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tcerg1l T C 7: 138,276,676 probably null Het
Tex12 T C 9: 50,559,287 probably null Het
Tgm5 T C 2: 121,076,961 I94V probably benign Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trbv4 A C 6: 41,059,712 D57A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tuba4a T C 1: 75,215,782 D396G probably benign Het
Txnrd2 C G 16: 18,426,425 probably null Het
Zfp445 T C 9: 122,852,524 N784S probably benign Het
Zfp459 G T 13: 67,408,443 L174I probably benign Het
Other mutations in Prkcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Prkcd APN 14 30602422 splice site probably benign
IGL00715:Prkcd APN 14 30596003 missense probably damaging 1.00
IGL01914:Prkcd APN 14 30607426 missense possibly damaging 0.49
IGL02177:Prkcd APN 14 30605887 missense probably damaging 1.00
IGL02547:Prkcd APN 14 30599469 missense probably damaging 1.00
IGL02681:Prkcd APN 14 30601233 critical splice acceptor site probably null
Rigged UTSW 14 30610301 start codon destroyed probably null 0.99
rigged2 UTSW 14 30599743 missense probably damaging 1.00
IGL03014:Prkcd UTSW 14 30607337 missense probably damaging 1.00
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R0240:Prkcd UTSW 14 30602088 missense probably damaging 0.97
R1385:Prkcd UTSW 14 30607405 missense probably damaging 1.00
R1567:Prkcd UTSW 14 30607448 missense probably benign 0.35
R2114:Prkcd UTSW 14 30605851 missense probably damaging 1.00
R2983:Prkcd UTSW 14 30599478 missense probably damaging 1.00
R3716:Prkcd UTSW 14 30599712 missense probably benign 0.00
R4162:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4164:Prkcd UTSW 14 30601197 missense probably damaging 0.98
R4637:Prkcd UTSW 14 30598765 missense probably benign 0.00
R4750:Prkcd UTSW 14 30610301 start codon destroyed probably null 0.99
R4756:Prkcd UTSW 14 30599666 missense probably benign 0.00
R4849:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4850:Prkcd UTSW 14 30599743 missense probably damaging 1.00
R4893:Prkcd UTSW 14 30599425 missense probably damaging 1.00
R4914:Prkcd UTSW 14 30605438 critical splice donor site probably null
R4925:Prkcd UTSW 14 30607613 missense probably damaging 0.98
R5644:Prkcd UTSW 14 30607413 missense probably benign 0.06
R5832:Prkcd UTSW 14 30605821 missense probably damaging 0.99
R5910:Prkcd UTSW 14 30595981 missense probably benign 0.01
R6049:Prkcd UTSW 14 30607297 missense possibly damaging 0.95
R6322:Prkcd UTSW 14 30599663 missense probably damaging 1.00
R7177:Prkcd UTSW 14 30599707 missense probably damaging 1.00
R7358:Prkcd UTSW 14 30605836 missense probably benign
R7494:Prkcd UTSW 14 30609193 missense probably benign 0.00
R7554:Prkcd UTSW 14 30609263 missense probably damaging 0.96
R7778:Prkcd UTSW 14 30605815 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGGGTGCTTCTGTCTTC -3'
(R):5'- TGCTAACACTGAGTGCAGAGG -3'

Sequencing Primer
(F):5'- ATCCTCAGCTGGGTCGTTCAG -3'
(R):5'- AGAGGTCCCTGGCATGTACAG -3'
Posted On2015-06-10