Mutagenetix > Incidental Mutation

Incidental Mutation 'R4180:Pdzrn4'

319706

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

041016-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R4180 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92402017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 256 (V256D)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169942
AA Change: V256D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: V256D

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (52/54)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,441,578	S1326P	possibly damaging	Het
Adam22	T	G	5: 8,149,218	D246A	probably damaging	Het
Bmf	T	C	2: 118,532,537		probably benign	Het
Cd300lf	T	C	11: 115,124,263	Y160C	possibly damaging	Het
Chuk	G	A	19: 44,101,840	A71V	probably benign	Het
Col19a1	C	T	1: 24,270,392	G1060E	probably damaging	Het
Dock7	A	G	4: 99,016,736	V634A	probably benign	Het
Dpm3	A	G	3: 89,266,732		probably benign	Het
Dqx1	A	G	6: 83,059,479	T155A	probably benign	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Fam184b	T	C	5: 45,539,764	E686G	probably benign	Het
Fhad1	T	A	4: 141,985,543	D195V	possibly damaging	Het
Glis2	T	C	16: 4,611,376	S148P	probably benign	Het
Gm8587	C	T	12: 88,089,746		noncoding transcript	Het
Gon7	A	G	12: 102,754,104	S90P	probably benign	Het
Haus6	A	T	4: 86,583,574	W687R	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Idh3g	A	T	X: 73,782,004		probably null	Het
Ints9	T	C	14: 64,992,981	L119P	probably damaging	Het
Itga9	T	C	9: 118,607,078	Y51H	probably damaging	Het
Klf17	T	A	4: 117,759,186	H316L	probably benign	Het
Klf4	C	T	4: 55,530,884	G26R	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lhcgr	A	G	17: 88,742,283	V605A	probably damaging	Het
Mafa	T	C	15: 75,747,564	Y120C	possibly damaging	Het
Map3k20	A	G	2: 72,441,571	Y681C	probably damaging	Het
Nub1	T	C	5: 24,692,877	I87T	probably damaging	Het
Olfr356	T	A	2: 36,937,230	V37D	probably damaging	Het
Pak2	C	G	16: 32,052,187	G59A	probably benign	Het
Pkd2l1	T	C	19: 44,192,181	N32D	probably benign	Het
Plec	T	C	15: 76,180,215	K1953R	possibly damaging	Het
Plekhg4	T	A	8: 105,381,398	V1029E	possibly damaging	Het
Prkcd	A	G	14: 30,610,304		probably benign	Het
Rgcc	T	C	14: 79,300,715	S79G	probably benign	Het
Sspo	T	C	6: 48,498,395		probably null	Het
Stxbp5l	A	T	16: 37,247,880	C315S	probably benign	Het
Tc2n	A	G	12: 101,665,695	L301P	probably damaging	Het
Tcerg1l	T	C	7: 138,276,676		probably null	Het
Tex12	T	C	9: 50,559,287		probably null	Het
Tgm5	T	C	2: 121,076,961	I94V	probably benign	Het
Tonsl	A	G	15: 76,624,475	L26P	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trbv4	A	C	6: 41,059,712	D57A	possibly damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tuba4a	T	C	1: 75,215,782	D396G	probably benign	Het
Txnrd2	C	G	16: 18,426,425		probably null	Het
Zfp445	T	C	9: 122,852,524	N784S	probably benign	Het
Zfp459	G	T	13: 67,408,443	L174I	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGAGAGTTGCATGTTGGAGC -3'
(R):5'- GCTGAAAACTTGAGGCAGTTC -3'

Sequencing Primer
(F):5'- GCATGTTGGAGCAGAATTATTGATAG -3'
(R):5'- CCTATCTGCTGATTGATACTGAATC -3'

Posted On

2015-06-10