Incidental Mutation 'R4180:Chuk'
ID319712
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 041016-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4180 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44101840 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 71 (A71V)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably benign
Transcript: ENSMUST00000026217
AA Change: A71V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: A71V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119591
AA Change: A71V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: A71V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,441,578 S1326P possibly damaging Het
Adam22 T G 5: 8,149,218 D246A probably damaging Het
Bmf T C 2: 118,532,537 probably benign Het
Cd300lf T C 11: 115,124,263 Y160C possibly damaging Het
Col19a1 C T 1: 24,270,392 G1060E probably damaging Het
Dock7 A G 4: 99,016,736 V634A probably benign Het
Dpm3 A G 3: 89,266,732 probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Fam184b T C 5: 45,539,764 E686G probably benign Het
Fhad1 T A 4: 141,985,543 D195V possibly damaging Het
Glis2 T C 16: 4,611,376 S148P probably benign Het
Gm8587 C T 12: 88,089,746 noncoding transcript Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Haus6 A T 4: 86,583,574 W687R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Ints9 T C 14: 64,992,981 L119P probably damaging Het
Itga9 T C 9: 118,607,078 Y51H probably damaging Het
Klf17 T A 4: 117,759,186 H316L probably benign Het
Klf4 C T 4: 55,530,884 G26R possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lhcgr A G 17: 88,742,283 V605A probably damaging Het
Mafa T C 15: 75,747,564 Y120C possibly damaging Het
Map3k20 A G 2: 72,441,571 Y681C probably damaging Het
Nub1 T C 5: 24,692,877 I87T probably damaging Het
Olfr356 T A 2: 36,937,230 V37D probably damaging Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pdzrn4 T A 15: 92,402,017 V256D possibly damaging Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkcd A G 14: 30,610,304 probably benign Het
Rgcc T C 14: 79,300,715 S79G probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Stxbp5l A T 16: 37,247,880 C315S probably benign Het
Tc2n A G 12: 101,665,695 L301P probably damaging Het
Tcerg1l T C 7: 138,276,676 probably null Het
Tex12 T C 9: 50,559,287 probably null Het
Tgm5 T C 2: 121,076,961 I94V probably benign Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trbv4 A C 6: 41,059,712 D57A possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tuba4a T C 1: 75,215,782 D396G probably benign Het
Txnrd2 C G 16: 18,426,425 probably null Het
Zfp445 T C 9: 122,852,524 N784S probably benign Het
Zfp459 G T 13: 67,408,443 L174I probably benign Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACATGTGACTCAGAAACGGC -3'
(R):5'- CACAGAAATGTGGTCATAACAGTGATG -3'

Sequencing Primer
(F):5'- GTGACTCAGAAACGGCTAATGTTTG -3'
(R):5'- TGGTCATAACAGTGATGGTATTTTTC -3'
Posted On2015-06-10