Mutagenetix > Incidental Mutation

Incidental Mutation 'R4181:Chil4'

319725

Institutional Source

Beutler Lab

Gene Symbol

Chil4

Ensembl Gene

ENSMUSG00000063779

Gene Name

chitinase-like 4

Synonyms

Ym2, Chi3l4

MMRRC Submission

041017-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4181 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

106201490-106219507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106203727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 284 (P284S)

Ref Sequence

ENSEMBL: ENSMUSP00000080851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082219]

AlphaFold

Q91Z98

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082219
AA Change: P284S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: P284S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	1.77e-132	SMART

Meta Mutation Damage Score

0.6164

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

92% (48/52)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agl	T	C	3: 116,746,630	Y1445C	probably damaging	Het
Arhgap12	T	C	18: 6,111,734	D210G	probably damaging	Het
Atp11b	A	G	3: 35,789,558	T185A	probably damaging	Het
Atp11b	A	G	3: 35,800,565	K284R	probably benign	Het
Bcas1	A	G	2: 170,418,627	V44A	probably benign	Het
Carmil3	G	A	14: 55,503,955	D1066N	probably benign	Het
Clic4	A	G	4: 135,226,039	V98A	probably benign	Het
Cmpk2	T	C	12: 26,477,047	V345A	probably damaging	Het
Col6a3	A	T	1: 90,807,614	I771N	probably damaging	Het
Cyp2d34	A	T	15: 82,617,285		probably null	Het
Cyp7a1	C	T	4: 6,271,205	G317E	probably benign	Het
Ddx1	A	T	12: 13,231,503	L353*	probably null	Het
Dnhd1	T	A	7: 105,693,954	W1502R	probably damaging	Het
Drc1	T	C	5: 30,355,713	V377A	probably benign	Het
Fyb	A	G	15: 6,580,923	N326D	probably benign	Het
Gapdh	C	T	6: 125,165,234		probably benign	Het
Gm973	A	G	1: 59,551,240	Y302C	possibly damaging	Het
Grsf1	G	A	5: 88,664,156	P271S	probably benign	Het
Gtpbp3	C	T	8: 71,491,467	T285I	probably damaging	Het
Hnrnpul1	T	C	7: 25,726,812	D538G	probably damaging	Het
Kif26b	G	A	1: 178,915,426	S582N	probably damaging	Het
Lgals4	T	C	7: 28,836,012	V107A	possibly damaging	Het
Lmbr1l	A	T	15: 98,908,720	L270Q	possibly damaging	Het
Loxl4	T	A	19: 42,607,591	Y141F	probably benign	Het
Lpcat3	C	T	6: 124,703,224		probably benign	Het
Lrp1b	G	A	2: 40,611,434	T219I	probably damaging	Het
Man2a2	T	A	7: 80,351,739	E1140V	possibly damaging	Het
Mapk8	T	C	14: 33,382,220	D413G	probably damaging	Het
Olfr1055	A	T	2: 86,347,237	H176Q	probably damaging	Het
Olfr747	C	G	14: 50,681,050	E195Q	probably benign	Het
Olfr849	C	T	9: 19,441,735	A274V	possibly damaging	Het
Pdss1	T	C	2: 22,915,505	I265T	probably damaging	Het
Piezo2	T	C	18: 63,124,730		probably null	Het
Rad50	T	A	11: 53,702,005	N106I	probably benign	Het
Rbbp6	A	G	7: 122,994,735	Y568C	probably damaging	Het
Rorc	G	A	3: 94,387,193	C33Y	probably damaging	Het
Ssc4d	T	C	5: 135,961,924	E470G	possibly damaging	Het
Tnxb	T	G	17: 34,709,454	V2614G	possibly damaging	Het
Trip11	A	T	12: 101,893,768	D282E	probably damaging	Het
Ttn	G	T	2: 76,876,467		probably benign	Het
Vangl1	A	T	3: 102,165,781		probably benign	Het
Wdr66	T	C	5: 123,293,810	I549T	probably benign	Het
Wiz	T	C	17: 32,367,985	E117G	probably damaging	Het
Zfp982	A	G	4: 147,512,693	K169R	probably benign	Het

Other mutations in Chil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Chil4	APN	3	106201797	missense	probably benign
IGL02457:Chil4	APN	3	106214399	missense	probably benign
R1087:Chil4	UTSW	3	106210565	missense	probably benign	0.01
R1398:Chil4	UTSW	3	106219509	splice site	probably null
R1503:Chil4	UTSW	3	106206034	missense	probably benign
R1553:Chil4	UTSW	3	106203690	missense	probably benign	0.02
R1806:Chil4	UTSW	3	106210643	splice site	probably benign
R1873:Chil4	UTSW	3	106206098	missense	probably benign	0.00
R2069:Chil4	UTSW	3	106219455	missense	probably benign	0.16
R2100:Chil4	UTSW	3	106214347	missense	probably benign
R2370:Chil4	UTSW	3	106214300	nonsense	probably null
R2984:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R2985:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R3522:Chil4	UTSW	3	106203740	missense	probably benign	0.08
R3919:Chil4	UTSW	3	106202532	missense	probably benign	0.00
R4033:Chil4	UTSW	3	106214449	missense	probably damaging	1.00
R4184:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4301:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4347:Chil4	UTSW	3	106202828	missense	probably benign
R4391:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4395:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4418:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4483:Chil4	UTSW	3	106214362	missense	probably damaging	1.00
R4544:Chil4	UTSW	3	106210606	missense	probably damaging	0.97
R4887:Chil4	UTSW	3	106204144	missense	probably benign	0.01
R4949:Chil4	UTSW	3	106206092	missense	possibly damaging	0.83
R5076:Chil4	UTSW	3	106202597	missense	probably damaging	1.00
R5146:Chil4	UTSW	3	106202834	missense	probably benign	0.18
R5254:Chil4	UTSW	3	106219452	missense	probably benign	0.00
R5521:Chil4	UTSW	3	106203697	missense	possibly damaging	0.50
R5790:Chil4	UTSW	3	106202578	missense	probably benign	0.00
R5883:Chil4	UTSW	3	106210570	missense	possibly damaging	0.48
R6010:Chil4	UTSW	3	106214395	missense	probably damaging	1.00
R6257:Chil4	UTSW	3	106204096	missense	possibly damaging	0.84
R6269:Chil4	UTSW	3	106204171	missense	probably damaging	1.00
R6602:Chil4	UTSW	3	106210590	missense	probably benign	0.00
R7113:Chil4	UTSW	3	106202767	missense	probably damaging	1.00
R7113:Chil4	UTSW	3	106214348	missense	probably benign
R7188:Chil4	UTSW	3	106204159	missense	probably damaging	1.00
R7980:Chil4	UTSW	3	106202744	missense	probably damaging	1.00
R8810:Chil4	UTSW	3	106201805	missense	probably damaging	0.99
R9300:Chil4	UTSW	3	106202558	missense	probably benign	0.10
R9307:Chil4	UTSW	3	106204066	critical splice donor site	probably null
R9529:Chil4	UTSW	3	106211340	missense	probably damaging	1.00
X0067:Chil4	UTSW	3	106206034	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCATGTTGTATCTGCTTAGGAAGAG -3'
(R):5'- TCACACAATTTGAGATACAAGAGGG -3'

Sequencing Primer
(F):5'- TCTGCTTAGGAAGAGTACATACTG -3'
(R):5'- AGGGGAGAACTAACCTATATAAACAC -3'

Posted On

2015-06-10