Incidental Mutation 'R4181:Agl'
ID319726
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4181 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116746630 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1445 (Y1445C)
Ref Sequence ENSEMBL: ENSMUSP00000124149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: Y1445C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: Y1445C

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160484
AA Change: Y780C
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: Y780C

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: Y1445C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: Y1445C

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Meta Mutation Damage Score 0.9732 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
X0065:Agl UTSW 3 116781330 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAGTCTTCGCAGCAGTCTC -3'
(R):5'- AGCTCACGCTGCAGATTAG -3'

Sequencing Primer
(F):5'- TTCGCAGCAGTCTCTGGAC -3'
(R):5'- CTCACGCTGCAGATTAGGAAAG -3'
Posted On2015-06-10