Incidental Mutation 'R4181:Zfp982'
ID319729
Institutional Source Beutler Lab
Gene Symbol Zfp982
Ensembl Gene ENSMUSG00000078496
Gene Namezinc finger protein 982
SynonymsGm13152
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4181 (G1)
Quality Score156
Status Validated
Chromosome4
Chromosomal Location147492417-147513486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147512693 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 169 (K169R)
Ref Sequence ENSEMBL: ENSMUSP00000101346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063704] [ENSMUST00000105721]
Predicted Effect probably benign
Transcript: ENSMUST00000063704
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068021
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105721
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101346
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Other mutations in Zfp982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Zfp982 APN 4 147512369 missense probably benign
IGL02989:Zfp982 APN 4 147512595 missense possibly damaging 0.47
R0035:Zfp982 UTSW 4 147512692 missense probably benign 0.00
R0123:Zfp982 UTSW 4 147512636 missense probably benign 0.04
R1502:Zfp982 UTSW 4 147512669 missense probably benign 0.00
R1982:Zfp982 UTSW 4 147512592 nonsense probably null
R4182:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4183:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4184:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4427:Zfp982 UTSW 4 147512623 nonsense probably null
R4814:Zfp982 UTSW 4 147512633 missense possibly damaging 0.58
R5697:Zfp982 UTSW 4 147512589 missense probably benign 0.02
R5777:Zfp982 UTSW 4 147510864 missense probably damaging 1.00
R7233:Zfp982 UTSW 4 147513261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCCAGTACATTGTCCATGAAC -3'
(R):5'- CCTGTATGAATTCTCTGATGATCAC -3'

Sequencing Primer
(F):5'- GGGACAAATGCTTTTCCCAAAG -3'
(R):5'- GAATTCTCTGATGATCACTAAGACTG -3'
Posted On2015-06-10