Incidental Mutation 'R4182:Des'
List |< first << previous [record 10 of 38] next >> last >|
ID319759
Institutional Source Beutler Lab
Gene Symbol Des
Ensembl Gene ENSMUSG00000026208
Gene Namedesmin
Synonyms
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75360329-75368579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 75362584 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 251 (A251G)
Ref Sequence ENSEMBL: ENSMUSP00000027409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027409]
Predicted Effect probably benign
Transcript: ENSMUST00000027409
AA Change: A251G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027409
Gene: ENSMUSG00000026208
AA Change: A251G

DomainStartEndE-ValueType
Pfam:Filament_head 9 105 1.3e-25 PFAM
Filament 106 414 7.41e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144894
Meta Mutation Damage Score 0.4586 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane and are essential for maintaining the strength and integrity of skeletal, cardiac and smooth muscle fibers. Mutations in this gene affect assembly of intermediate filaments. Mice lacking this gene are able to develop and reproduce but exhibit abnormal muscle fibers. Mutations in the human gene are associated with myofibrillar myopathy, dilated cardiomyopathy, neurogenic scapuloperoneal syndrome and autosomal recessive limb-girdle muscular dystrophy, type 2R. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit histologically detectable defects of cardiac, skeletal, and smooth muscle. Defects in the heart are most severe, and lead to calcification, progressive degeneration, and necrosis of the myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Des
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Des APN 1 75362583 missense probably benign 0.02
IGL02416:Des APN 1 75362728 critical splice donor site probably null
IGL02953:Des APN 1 75363644 missense possibly damaging 0.95
IGL03156:Des APN 1 75362996 missense probably damaging 1.00
IGL03288:Des APN 1 75362341 missense possibly damaging 0.79
R0032:Des UTSW 1 75362166 missense possibly damaging 0.87
R0849:Des UTSW 1 75360628 missense probably benign
R0885:Des UTSW 1 75360730 missense probably damaging 1.00
R1271:Des UTSW 1 75360646 missense probably benign 0.01
R1452:Des UTSW 1 75363477 missense probably damaging 1.00
R1559:Des UTSW 1 75360586 missense probably benign 0.11
R1929:Des UTSW 1 75363493 missense probably damaging 0.99
R2144:Des UTSW 1 75366804 missense probably benign 0.45
R2145:Des UTSW 1 75363464 splice site probably benign
R2271:Des UTSW 1 75363493 missense probably damaging 0.99
R4184:Des UTSW 1 75362584 missense probably benign 0.00
R4383:Des UTSW 1 75360769 missense possibly damaging 0.94
R5268:Des UTSW 1 75362928 missense possibly damaging 0.50
R5787:Des UTSW 1 75363646 missense probably damaging 0.98
R5974:Des UTSW 1 75362984 missense probably benign 0.10
R6044:Des UTSW 1 75363469 critical splice acceptor site probably null
R6985:Des UTSW 1 75366787 missense possibly damaging 0.80
R7359:Des UTSW 1 75360952 missense probably damaging 1.00
R7467:Des UTSW 1 75362961 missense possibly damaging 0.48
R7798:Des UTSW 1 75362359 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCGCAGAATCGAATCCCTC -3'
(R):5'- CTGAGTTCCTAGGCTAGACCAC -3'

Sequencing Primer
(F):5'- CGCGTTCCTTAAGAAAGTGC -3'
(R):5'- TAGACCACCCACCTTGGACTTG -3'
Posted On2015-06-10