Incidental Mutation 'R4182:Tgfb2'
ID 319761
Institutional Source Beutler Lab
Gene Symbol Tgfb2
Ensembl Gene ENSMUSG00000039239
Gene Name transforming growth factor, beta 2
Synonyms Tgfb-2, Tgf-beta2
MMRRC Submission 041018-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4182 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 186354989-186438186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 186361222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 315 (D315V)
Ref Sequence ENSEMBL: ENSMUSP00000043849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]
AlphaFold P27090
Predicted Effect possibly damaging
Transcript: ENSMUST00000045288
AA Change: D315V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239
AA Change: D315V

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194960
Predicted Effect possibly damaging
Transcript: ENSMUST00000195201
AA Change: D343V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: D343V

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Meta Mutation Damage Score 0.4970 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 (GRCm39) D210G probably damaging Het
Baz2b A T 2: 59,928,801 (GRCm39) probably benign Het
Bcl9 A G 3: 97,120,999 (GRCm39) probably null Het
Cfap20 A T 8: 96,151,284 (GRCm39) I19N probably damaging Het
Clnk T A 5: 38,905,193 (GRCm39) probably benign Het
Col18a1 C T 10: 76,894,675 (GRCm39) probably null Het
Cux2 C T 5: 122,006,555 (GRCm39) G905D probably damaging Het
Ddx1 A T 12: 13,281,504 (GRCm39) L353* probably null Het
Ddx59 T A 1: 136,367,599 (GRCm39) S569T probably benign Het
Des C G 1: 75,339,228 (GRCm39) A251G probably benign Het
Dnajc21 T C 15: 10,460,019 (GRCm39) probably null Het
Fam217a T C 13: 35,094,239 (GRCm39) T416A possibly damaging Het
Gbp9 T A 5: 105,231,461 (GRCm39) Q375L probably benign Het
Grsf1 G A 5: 88,812,015 (GRCm39) P271S probably benign Het
H2-T24 A T 17: 36,326,376 (GRCm39) N174K possibly damaging Het
Heatr3 T C 8: 88,897,630 (GRCm39) probably benign Het
Lurap1l G A 4: 80,872,095 (GRCm39) S196N probably benign Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Nbea A G 3: 55,915,848 (GRCm39) C875R probably damaging Het
Nme1 G A 11: 93,851,630 (GRCm39) T87I probably benign Het
Nphp3 T C 9: 103,915,663 (GRCm39) S124P probably benign Het
Nrap C T 19: 56,338,759 (GRCm39) V907M probably damaging Het
Or1o2 T G 17: 37,542,739 (GRCm39) H174P possibly damaging Het
Or4f59 G T 2: 111,872,873 (GRCm39) P168Q probably damaging Het
Pcdhga8 A G 18: 37,860,336 (GRCm39) N464S probably damaging Het
Pdcd6ip T C 9: 113,529,078 (GRCm39) I75V probably benign Het
Ralgapa2 G A 2: 146,277,914 (GRCm39) P416S probably damaging Het
Saal1 A G 7: 46,360,076 (GRCm39) probably benign Het
Susd5 A G 9: 113,925,053 (GRCm39) E312G probably benign Het
Tll1 C T 8: 64,494,545 (GRCm39) D737N probably damaging Het
Tmem115 A G 9: 107,412,482 (GRCm39) T269A probably damaging Het
Ttc39b T C 4: 83,155,538 (GRCm39) D490G probably damaging Het
Vmn1r72 C T 7: 11,403,995 (GRCm39) R151K probably benign Het
Vmn2r74 A T 7: 85,606,395 (GRCm39) F317Y possibly damaging Het
Vmn2r79 A G 7: 86,651,099 (GRCm39) H166R possibly damaging Het
Zfp560 A G 9: 20,258,744 (GRCm39) I706T probably benign Het
Zfp982 A G 4: 147,597,150 (GRCm39) K169R probably benign Het
Other mutations in Tgfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Tgfb2 APN 1 186,436,784 (GRCm39) missense probably benign 0.39
IGL01304:Tgfb2 APN 1 186,357,670 (GRCm39) missense probably damaging 0.99
IGL03028:Tgfb2 APN 1 186,362,806 (GRCm39) critical splice donor site probably null
PIT4486001:Tgfb2 UTSW 1 186,422,924 (GRCm39) missense probably benign 0.04
R2017:Tgfb2 UTSW 1 186,362,962 (GRCm39) nonsense probably null
R2880:Tgfb2 UTSW 1 186,436,752 (GRCm39) missense probably damaging 1.00
R4292:Tgfb2 UTSW 1 186,364,735 (GRCm39) missense probably damaging 1.00
R4478:Tgfb2 UTSW 1 186,364,696 (GRCm39) missense probably damaging 1.00
R4801:Tgfb2 UTSW 1 186,361,110 (GRCm39) nonsense probably null
R4802:Tgfb2 UTSW 1 186,361,110 (GRCm39) nonsense probably null
R5247:Tgfb2 UTSW 1 186,382,111 (GRCm39) splice site probably null
R5254:Tgfb2 UTSW 1 186,436,680 (GRCm39) missense probably damaging 1.00
R5614:Tgfb2 UTSW 1 186,357,710 (GRCm39) missense probably benign 0.21
R5988:Tgfb2 UTSW 1 186,436,778 (GRCm39) missense probably benign 0.05
R6898:Tgfb2 UTSW 1 186,364,697 (GRCm39) missense probably damaging 1.00
R6961:Tgfb2 UTSW 1 186,382,032 (GRCm39) missense possibly damaging 0.67
R7098:Tgfb2 UTSW 1 186,362,834 (GRCm39) missense probably damaging 1.00
R7346:Tgfb2 UTSW 1 186,382,077 (GRCm39) missense probably benign 0.00
R7729:Tgfb2 UTSW 1 186,362,954 (GRCm39) missense possibly damaging 0.94
R8167:Tgfb2 UTSW 1 186,422,942 (GRCm39) missense possibly damaging 0.94
R8825:Tgfb2 UTSW 1 186,361,136 (GRCm39) missense probably damaging 1.00
R8884:Tgfb2 UTSW 1 186,364,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGCAACTGTTGAGTTTGG -3'
(R):5'- AGGGACTCACAGTGTCTCAC -3'

Sequencing Primer
(F):5'- ATGGCCATCATCACTGACTTAGG -3'
(R):5'- GTGTCTCACTGTTGACATTACATGAG -3'
Posted On 2015-06-10