Incidental Mutation 'R4182:Olfr1312'
ID319763
Institutional Source Beutler Lab
Gene Symbol Olfr1312
Ensembl Gene ENSMUSG00000074947
Gene Nameolfactory receptor 1312
SynonymsGA_x6K02T2Q125-73090482-73089529, MOR245-20
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112038068-112050238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112042528 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 168 (P168Q)
Ref Sequence ENSEMBL: ENSMUSP00000149430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099600] [ENSMUST00000213582] [ENSMUST00000213961] [ENSMUST00000215531]
Predicted Effect probably damaging
Transcript: ENSMUST00000099600
AA Change: P168Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097195
Gene: ENSMUSG00000074947
AA Change: P168Q

DomainStartEndE-ValueType
Pfam:7tm_4 27 302 1.6e-43 PFAM
Pfam:7tm_1 38 284 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213582
AA Change: P168Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000213961
AA Change: P168Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215531
AA Change: P168Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Olfr1312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr1312 APN 2 112042371 missense probably benign 0.00
IGL01650:Olfr1312 APN 2 112042375 missense possibly damaging 0.84
IGL02390:Olfr1312 APN 2 112042711 missense possibly damaging 0.84
IGL03392:Olfr1312 APN 2 112042976 missense probably benign 0.00
R1170:Olfr1312 UTSW 2 112042215 missense probably benign 0.45
R1620:Olfr1312 UTSW 2 112042246 missense probably benign 0.07
R2083:Olfr1312 UTSW 2 112042553 missense probably benign 0.05
R3605:Olfr1312 UTSW 2 112042823 missense probably benign
R5739:Olfr1312 UTSW 2 112042783 missense probably damaging 0.99
R6321:Olfr1312 UTSW 2 112042768 missense probably benign 0.07
R7231:Olfr1312 UTSW 2 112042366 missense probably damaging 1.00
R7365:Olfr1312 UTSW 2 112043014 missense possibly damaging 0.95
R7673:Olfr1312 UTSW 2 112042580 missense probably benign
R7978:Olfr1312 UTSW 2 112042178 missense possibly damaging 0.92
R8112:Olfr1312 UTSW 2 112042637 missense probably damaging 1.00
R8167:Olfr1312 UTSW 2 112042444 missense possibly damaging 0.91
Z1177:Olfr1312 UTSW 2 112042655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGTAACATGAGCTGAAAG -3'
(R):5'- TTTTGCTCATAGCCATGGCC -3'

Sequencing Primer
(F):5'- CTGAAAGTGTGGACAGAGCCTTG -3'
(R):5'- ATAGCCATGGCCTTTGACAG -3'
Posted On2015-06-10