Incidental Mutation 'R4182:Zfp982'
List |< first << previous [record 38 of 38]
ID319768
Institutional Source Beutler Lab
Gene Symbol Zfp982
Ensembl Gene ENSMUSG00000078496
Gene Namezinc finger protein 982
SynonymsGm13152
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4182 (G1)
Quality Score100
Status Validated
Chromosome4
Chromosomal Location147492417-147513486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147512693 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 169 (K169R)
Ref Sequence ENSEMBL: ENSMUSP00000101346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063704] [ENSMUST00000105721]
Predicted Effect probably benign
Transcript: ENSMUST00000063704
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068021
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105721
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101346
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Other mutations in Zfp982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Zfp982 APN 4 147512369 missense probably benign
IGL02989:Zfp982 APN 4 147512595 missense possibly damaging 0.47
R0035:Zfp982 UTSW 4 147512692 missense probably benign 0.00
R0123:Zfp982 UTSW 4 147512636 missense probably benign 0.04
R1502:Zfp982 UTSW 4 147512669 missense probably benign 0.00
R1982:Zfp982 UTSW 4 147512592 nonsense probably null
R4181:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4183:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4184:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4427:Zfp982 UTSW 4 147512623 nonsense probably null
R4814:Zfp982 UTSW 4 147512633 missense possibly damaging 0.58
R5697:Zfp982 UTSW 4 147512589 missense probably benign 0.02
R5777:Zfp982 UTSW 4 147510864 missense probably damaging 1.00
R7233:Zfp982 UTSW 4 147513261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCAGTACATTGTCCATGAAC -3'
(R):5'- CTCCTGTATGAATTCTCTGATGATCAC -3'

Sequencing Primer
(F):5'- GGGACAAATGCTTTTCCCAAAG -3'
(R):5'- GAATTCTCTGATGATCACTAAGACTG -3'
Posted On2015-06-10