Incidental Mutation 'R4182:Clnk'
ID319769
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 38747850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114080
Predicted Effect probably benign
Transcript: ENSMUST00000169819
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171633
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177682
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R3931:Clnk UTSW 5 38768069 missense probably benign
R4159:Clnk UTSW 5 38741795 intron probably benign
R4686:Clnk UTSW 5 38741837 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R5811:Clnk UTSW 5 38713147 missense probably damaging 1.00
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7618:Clnk UTSW 5 38736355 missense probably benign 0.06
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
R8423:Clnk UTSW 5 38794910 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATAGCAAAGGGTCCACAGC -3'
(R):5'- CAGCATTTCAGTGAAGGACG -3'

Sequencing Primer
(F):5'- TAGCAAAGGGTCCACAGCCATAC -3'
(R):5'- CAGCATTTCAGTGAAGGACGATGTTC -3'
Posted On2015-06-10