Incidental Mutation 'R4182:Grsf1'
List |< first << previous [record 14 of 38] next >> last >|
ID319770
Institutional Source Beutler Lab
Gene Symbol Grsf1
Ensembl Gene ENSMUSG00000044221
Gene NameG-rich RNA sequence binding factor 1
SynonymsD5Wsu31e
MMRRC Submission 041018-MU
Accession Numbers

Genbank: NM_178700; MGI: 106479

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88659448-88676171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88664156 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 271 (P271S)
Ref Sequence ENSEMBL: ENSMUSP00000108860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078945] [ENSMUST00000113234] [ENSMUST00000153565]
Predicted Effect probably benign
Transcript: ENSMUST00000078945
AA Change: P388S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077972
Gene: ENSMUSG00000044221
AA Change: P388S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 64 101 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RRM 150 224 1.65e-6 SMART
RRM 250 321 1.79e-11 SMART
RRM 401 471 1.54e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113234
AA Change: P271S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108860
Gene: ENSMUSG00000044221
AA Change: P271S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
RRM 33 107 1.65e-6 SMART
RRM 133 204 1.79e-11 SMART
RRM 284 354 1.54e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130408
Predicted Effect probably benign
Transcript: ENSMUST00000153565
SMART Domains Protein: ENSMUSP00000123051
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
internal_repeat_1 2 33 5.45e-5 PROSPERO
RRM 52 123 1.79e-11 SMART
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cellular protein that binds RNAs containing the G-rich element. The protein is localized in the cytoplasm, and has been shown to stimulate translation of viral mRNAs in vitro. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Grsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Grsf1 APN 5 88670278 missense probably damaging 1.00
IGL01505:Grsf1 APN 5 88672749 nonsense probably null
IGL02108:Grsf1 APN 5 88665903 missense probably benign 0.35
IGL02116:Grsf1 APN 5 88670174 critical splice donor site probably null
IGL02713:Grsf1 APN 5 88672730 missense probably damaging 1.00
IGL02881:Grsf1 APN 5 88673830 missense probably damaging 1.00
R0336:Grsf1 UTSW 5 88663153 missense probably damaging 0.96
R1381:Grsf1 UTSW 5 88665864 missense probably benign 0.10
R1398:Grsf1 UTSW 5 88665847 missense probably benign 0.03
R2136:Grsf1 UTSW 5 88672658 missense probably benign 0.05
R2398:Grsf1 UTSW 5 88673836 missense probably damaging 1.00
R4181:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4183:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4184:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R5315:Grsf1 UTSW 5 88673775 start gained probably benign
R6246:Grsf1 UTSW 5 88662592 missense possibly damaging 0.81
R7359:Grsf1 UTSW 5 88665564 splice site probably null
R7381:Grsf1 UTSW 5 88665807 missense probably benign 0.02
R7430:Grsf1 UTSW 5 88663227 missense possibly damaging 0.67
R7703:Grsf1 UTSW 5 88671291 missense probably damaging 1.00
R7838:Grsf1 UTSW 5 88675664 start gained probably benign
R8013:Grsf1 UTSW 5 88675756 critical splice donor site probably null
YA93:Grsf1 UTSW 5 88673735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCTAAAAGGAAATTGC -3'
(R):5'- CAGGTGACAGCTGTTAAGTAGC -3'

Sequencing Primer
(F):5'- GGAAATTGCAGAAACTGTTTCCC -3'
(R):5'- AGCAGAAATTTCAGGTTTTGGCC -3'
Posted On2015-06-10