Incidental Mutation 'R4182:Naaa'
ID319771
Institutional Source Beutler Lab
Gene Symbol Naaa
Ensembl Gene ENSMUSG00000029413
Gene NameN-acylethanolamine acid amidase
Synonyms3830414F09Rik, Asahl, 2210023K21Rik
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92257659-92278170 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 92272554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113102] [ENSMUST00000159345] [ENSMUST00000175656]
Predicted Effect probably damaging
Transcript: ENSMUST00000113102
AA Change: V135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108726
Gene: ENSMUSG00000029413
AA Change: V135M

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 127 7.3e-26 PFAM
Pfam:CBAH 131 362 9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159345
AA Change: V133M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124582
Gene: ENSMUSG00000029413
AA Change: V133M

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NAAA-beta 36 125 1.3e-23 PFAM
Pfam:CBAH 129 360 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161212
Predicted Effect probably null
Transcript: ENSMUST00000175656
Meta Mutation Damage Score 0.7387 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Naaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Naaa APN 5 92265133 missense probably benign 0.32
IGL01470:Naaa APN 5 92263648 missense probably damaging 1.00
IGL01990:Naaa APN 5 92268063 missense possibly damaging 0.75
IGL02222:Naaa APN 5 92259550 unclassified probably benign
R0254:Naaa UTSW 5 92265135 missense probably damaging 1.00
R1658:Naaa UTSW 5 92272441 splice site probably null
R1930:Naaa UTSW 5 92278035 missense probably benign
R1931:Naaa UTSW 5 92278035 missense probably benign
R3788:Naaa UTSW 5 92272554 splice site probably null
R4373:Naaa UTSW 5 92278143 utr 5 prime probably benign
R4547:Naaa UTSW 5 92263586 splice site probably null
R5198:Naaa UTSW 5 92268045 nonsense probably null
R5732:Naaa UTSW 5 92263455 missense probably damaging 1.00
R6009:Naaa UTSW 5 92259581 missense probably benign
R7037:Naaa UTSW 5 92277075 missense possibly damaging 0.46
R7540:Naaa UTSW 5 92263724 missense probably benign 0.15
R8280:Naaa UTSW 5 92263449 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCATGGCTGTTCCTACTC -3'
(R):5'- GGGTCAATGACAGGGTCTAG -3'

Sequencing Primer
(F):5'- ACTCCTGATCTCTGCATGTG -3'
(R):5'- TCAATGACAGGGTCTAGATGTG -3'
Posted On2015-06-10