Incidental Mutation 'R4182:Cux2'
ID319773
Institutional Source Beutler Lab
Gene Symbol Cux2
Ensembl Gene ENSMUSG00000042589
Gene Namecut-like homeobox 2
SynonymsCutl2, Cux-2, ENSMUSG00000072641, 1700051K22Rik, Cux2
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121856366-122050102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121868492 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 905 (G905D)
Ref Sequence ENSEMBL: ENSMUSP00000130302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086317] [ENSMUST00000111752] [ENSMUST00000168288]
Predicted Effect probably damaging
Transcript: ENSMUST00000086317
AA Change: G905D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083497
Gene: ENSMUSG00000042589
AA Change: G905D

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111752
AA Change: G905D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107381
Gene: ENSMUSG00000042589
AA Change: G905D

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156942
SMART Domains Protein: ENSMUSP00000114239
Gene: ENSMUSG00000042589

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
CUT 50 135 7.62e-34 SMART
low complexity region 152 162 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168288
AA Change: G905D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130302
Gene: ENSMUSG00000042589
AA Change: G905D

DomainStartEndE-ValueType
coiled coil region 133 214 N/A INTRINSIC
coiled coil region 235 311 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
CUT 484 569 7.62e-34 SMART
coiled coil region 626 655 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 740 757 N/A INTRINSIC
CUT 829 917 6.52e-42 SMART
low complexity region 965 976 N/A INTRINSIC
CUT 984 1070 1.12e-40 SMART
HOX 1113 1175 7.54e-13 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197179
Meta Mutation Damage Score 0.2373 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene is a member of the Cut family of transcription factors that have multiple DNA binding domains and regulate cell proliferation and differentiation. This gene is primarily expressed in nervous tissues where it controls the proliferation of neuronal precursors, and may play a role in organogenesis earlier during embryonic development. Mice lacking the encoded protein exhibit smaller spinal cords with deficits in neural progenitor development as well as in neuroblast and interneuron differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Cux2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Cux2 APN 5 121868538 missense possibly damaging 0.92
IGL00917:Cux2 APN 5 121869105 missense probably null 0.05
IGL00979:Cux2 APN 5 121873714 missense probably damaging 0.98
IGL01069:Cux2 APN 5 121867351 missense possibly damaging 0.84
IGL01303:Cux2 APN 5 121865928 missense probably benign 0.03
IGL01583:Cux2 APN 5 121874107 missense probably damaging 0.98
IGL01762:Cux2 APN 5 121873145 missense probably damaging 1.00
IGL02508:Cux2 APN 5 121860822 missense possibly damaging 0.93
R0333:Cux2 UTSW 5 121860608 missense probably benign 0.04
R0352:Cux2 UTSW 5 121884739 splice site probably benign
R0443:Cux2 UTSW 5 121887437 missense possibly damaging 0.66
R1853:Cux2 UTSW 5 121869121 missense possibly damaging 0.95
R2011:Cux2 UTSW 5 121861326 missense probably benign 0.21
R2057:Cux2 UTSW 5 121869504 missense probably benign 0.02
R2165:Cux2 UTSW 5 121887477 missense possibly damaging 0.78
R3964:Cux2 UTSW 5 121887476 nonsense probably null
R4579:Cux2 UTSW 5 121860653 missense probably benign 0.01
R4655:Cux2 UTSW 5 121885934 missense possibly damaging 0.95
R4673:Cux2 UTSW 5 121887476 nonsense probably null
R4697:Cux2 UTSW 5 121873753 missense probably damaging 1.00
R4927:Cux2 UTSW 5 121877089 missense probably benign 0.13
R5348:Cux2 UTSW 5 121865978 missense probably damaging 0.99
R6208:Cux2 UTSW 5 121860822 missense possibly damaging 0.93
R6500:Cux2 UTSW 5 121864726 missense probably benign 0.03
R6661:Cux2 UTSW 5 121869297 missense probably benign 0.04
R6986:Cux2 UTSW 5 121868579 missense possibly damaging 0.84
R7296:Cux2 UTSW 5 121861256 missense probably benign 0.25
R7561:Cux2 UTSW 5 121879868 missense probably benign 0.31
R7702:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
R7705:Cux2 UTSW 5 121869673 missense probably benign 0.13
R7791:Cux2 UTSW 5 121867099 missense probably benign 0.10
R7998:Cux2 UTSW 5 121868585 missense possibly damaging 0.70
R8081:Cux2 UTSW 5 121869456 missense probably benign 0.13
R8096:Cux2 UTSW 5 121869097 missense possibly damaging 0.70
R8191:Cux2 UTSW 5 121874154 missense probably benign 0.31
X0027:Cux2 UTSW 5 121884751 missense probably benign 0.13
Z1176:Cux2 UTSW 5 121873813 nonsense probably null
Z1176:Cux2 UTSW 5 121885934 missense probably benign 0.02
Z1177:Cux2 UTSW 5 121873680 missense probably damaging 1.00
Z1177:Cux2 UTSW 5 121877129 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCTCTGCTGAGTGGAAACTTCC -3'
(R):5'- CATCTTGGAGGAGACCATGG -3'

Sequencing Primer
(F):5'- CTCCCATAGGAAGGAGGGG -3'
(R):5'- AGACCATGGGATGCCCTTTAG -3'
Posted On2015-06-10