Incidental Mutation 'R4182:Saal1'
List |< first << previous [record 28 of 38] next >> last >|
ID319775
Institutional Source Beutler Lab
Gene Symbol Saal1
Ensembl Gene ENSMUSG00000006763
Gene Nameserum amyloid A-like 1
Synonyms5031425D22Rik
MMRRC Submission 041018-MU
Accession Numbers

Genbank: NM_030233

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4182 (G1)
Quality Score146
Status Validated
Chromosome7
Chromosomal Location46686108-46710680 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 46710652 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006956] [ENSMUST00000143082] [ENSMUST00000210913]
Predicted Effect probably benign
Transcript: ENSMUST00000006956
SMART Domains Protein: ENSMUSP00000006956
Gene: ENSMUSG00000040026

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
SAA 21 122 1.12e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142381
AA Change: Y3H
Predicted Effect probably benign
Transcript: ENSMUST00000143082
SMART Domains Protein: ENSMUSP00000120658
Gene: ENSMUSG00000006763

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
SCOP:d1gw5a_ 40 455 2e-5 SMART
low complexity region 456 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145813
AA Change: Y4H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210791
Predicted Effect probably benign
Transcript: ENSMUST00000210913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211660
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Saal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Saal1 APN 7 46689799 splice site probably null
IGL03301:Saal1 APN 7 46702520 splice site probably benign
G5030:Saal1 UTSW 7 46692783 missense probably damaging 1.00
R0021:Saal1 UTSW 7 46692892 missense probably damaging 0.96
R0765:Saal1 UTSW 7 46699647 missense possibly damaging 0.76
R1086:Saal1 UTSW 7 46689459 splice site probably benign
R1273:Saal1 UTSW 7 46692942 missense probably damaging 0.99
R1466:Saal1 UTSW 7 46702545 splice site probably null
R1466:Saal1 UTSW 7 46702545 splice site probably null
R1661:Saal1 UTSW 7 46692800 missense possibly damaging 0.93
R1695:Saal1 UTSW 7 46692916 missense probably damaging 0.97
R2018:Saal1 UTSW 7 46699489 missense possibly damaging 0.93
R2058:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R2059:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R2326:Saal1 UTSW 7 46692811 missense probably benign 0.02
R4704:Saal1 UTSW 7 46699740 intron probably benign
R4831:Saal1 UTSW 7 46699647 missense probably benign 0.22
R5270:Saal1 UTSW 7 46701733 intron probably benign
R5471:Saal1 UTSW 7 46699648 missense probably benign 0.06
R5790:Saal1 UTSW 7 46701928 missense probably damaging 1.00
R6699:Saal1 UTSW 7 46692817 missense probably damaging 1.00
R6804:Saal1 UTSW 7 46699640 frame shift probably null
R6934:Saal1 UTSW 7 46702664 missense probably benign 0.00
R7863:Saal1 UTSW 7 46692903 missense probably benign 0.08
R8076:Saal1 UTSW 7 46710607 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTAGTCCATCGGCACCC -3'
(R):5'- AACATATCTGGACATGGCAGTTAC -3'

Sequencing Primer
(F):5'- GTCCACTCCCTGGGCAC -3'
(R):5'- CTGGACATGGCAGTTACTGTGTG -3'
Posted On2015-06-10