Incidental Mutation 'R0395:Slf1'
ID31978
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 038601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0395 (G1)
Quality Score207
Status Validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 77105969 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
Predicted Effect probably benign
Transcript: ENSMUST00000151524
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159300
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159462
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect probably benign
Transcript: ENSMUST00000162921
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162944
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Acsm2 G A 7: 119,575,746 D245N probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apba2 T A 7: 64,743,408 I547N probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Col16a1 G A 4: 130,073,109 G583D probably damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Mast4 T C 13: 102,735,273 E2529G probably damaging Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Per1 T A 11: 69,102,277 I340N probably damaging Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 unclassified probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGCCTAAAACATAGACCTACACA -3'
(R):5'- CAAGACAGTTTCTTCATAGGTGGGCAA -3'

Sequencing Primer
(F):5'- AGACCTACACAAATTTTCCATTCTGC -3'
(R):5'- CAGTATTTTACCAGTGTTTAGTAGCC -3'
Posted On2013-04-24