Incidental Mutation 'R4182:Susd5'
ID319785
Institutional Source Beutler Lab
Gene Symbol Susd5
Ensembl Gene ENSMUSG00000086596
Gene Namesushi domain containing 5
SynonymsLOC382111
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114057140-114098728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114095985 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 312 (E312G)
Ref Sequence ENSEMBL: ENSMUSP00000128826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135338]
Predicted Effect probably benign
Transcript: ENSMUST00000135338
AA Change: E312G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128826
Gene: ENSMUSG00000086596
AA Change: E312G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LINK 33 130 7.42e-26 SMART
CCP 136 193 9.65e-1 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 485 496 N/A INTRINSIC
transmembrane domain 566 588 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Susd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Susd5 APN 9 114068879 splice site probably benign
IGL01720:Susd5 APN 9 114063984 missense possibly damaging 0.85
IGL02739:Susd5 APN 9 114096033 missense possibly damaging 0.72
H8441:Susd5 UTSW 9 114096185 nonsense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0650:Susd5 UTSW 9 114082535 missense possibly damaging 0.53
R0666:Susd5 UTSW 9 114095784 missense possibly damaging 0.53
R1478:Susd5 UTSW 9 114096684 missense probably benign
R1672:Susd5 UTSW 9 114068822 missense probably damaging 0.99
R3416:Susd5 UTSW 9 114095658 missense possibly damaging 0.85
R3965:Susd5 UTSW 9 114096192 missense possibly damaging 0.72
R4514:Susd5 UTSW 9 114095924 missense probably benign 0.18
R5373:Susd5 UTSW 9 114082585 missense probably damaging 1.00
R5947:Susd5 UTSW 9 114057591 missense possibly damaging 0.96
R6189:Susd5 UTSW 9 114095658 missense probably damaging 0.98
R6349:Susd5 UTSW 9 114095802 missense probably benign 0.33
R7535:Susd5 UTSW 9 114064040 missense possibly damaging 0.92
Z1176:Susd5 UTSW 9 114096140 missense probably damaging 0.98
Z1177:Susd5 UTSW 9 114064067 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAAAACAAGATCGTCTGGTCTTC -3'
(R):5'- TCTGTCACAGGGTAGCCATC -3'

Sequencing Primer
(F):5'- AAACAAGATCGTCTGGTCTTCACTTC -3'
(R):5'- TCTAACCAGGAATCGTCGCTG -3'
Posted On2015-06-10