Incidental Mutation 'R4182:Nme1'
ID319787
Institutional Source Beutler Lab
Gene Symbol Nme1
Ensembl Gene ENSMUSG00000037601
Gene NameNME/NM23 nucleoside diphosphate kinase 1
SynonymsNDPK-A, non-metastatic cells 1, protein (NM23A) expressed in, NM23-M1
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93956979-93968521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93960804 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 87 (T87I)
Ref Sequence ENSEMBL: ENSMUSP00000103475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021217] [ENSMUST00000021220] [ENSMUST00000107844] [ENSMUST00000135884] [ENSMUST00000170303]
Predicted Effect probably benign
Transcript: ENSMUST00000021217
SMART Domains Protein: ENSMUSP00000021217
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021220
SMART Domains Protein: ENSMUSP00000021220
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 127 8.86e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107844
AA Change: T87I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103475
Gene: ENSMUSG00000037601
AA Change: T87I

DomainStartEndE-ValueType
NDK 4 102 4.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135884
SMART Domains Protein: ENSMUSP00000117022
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 141 5.74e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170303
SMART Domains Protein: ENSMUSP00000132590
Gene: ENSMUSG00000091228

DomainStartEndE-ValueType
NDK 4 118 7.56e-55 SMART
NDK 119 256 2.8e-90 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation of this gene are born normally, but exhibited high perinatal mortality of all genotypes on congenic backgrounds. This appears to be a maternal effect because the presence of a single functioning allele in females can prevent this mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Nme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Nme1 APN 11 93959491 missense possibly damaging 0.58
IGL02533:Nme1 APN 11 93959431 missense possibly damaging 0.89
R1695:Nme1 UTSW 11 93960767 missense probably benign 0.37
R2512:Nme1 UTSW 11 93960687 missense possibly damaging 0.73
R4701:Nme1 UTSW 11 93965908 missense probably damaging 1.00
R6928:Nme1 UTSW 11 93959403 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAAATTCCTGTGGCAAGTAGC -3'
(R):5'- CATTTCAAAAGATTGCTGGAAGCC -3'

Sequencing Primer
(F):5'- CCTGTGGCAAGTAGCTAGGATTTG -3'
(R):5'- CACACGGATGGGTCTGAATTGATC -3'
Posted On2015-06-10