Incidental Mutation 'R4182:Fam217a'
ID319789
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34910256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 416 (T416A)
Ref Sequence ENSEMBL: ENSMUSP00000153128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021851
AA Change: T507A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: T507A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223228
Predicted Effect probably benign
Transcript: ENSMUST00000223834
AA Change: T659A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224613
Predicted Effect possibly damaging
Transcript: ENSMUST00000225242
AA Change: T416A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R2344:Fam217a UTSW 13 34910335 missense probably damaging 1.00
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R5583:Fam217a UTSW 13 34910297 missense probably damaging 1.00
R6027:Fam217a UTSW 13 34910994 missense possibly damaging 0.77
R6496:Fam217a UTSW 13 34910802 nonsense probably null
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7394:Fam217a UTSW 13 34910279 missense possibly damaging 0.73
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
R8409:Fam217a UTSW 13 34916898 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAACGGCAACTCTTACCTG -3'
(R):5'- AGGTCCCCAATGCCAGTTTC -3'

Sequencing Primer
(F):5'- TGGAATCATTGGGAAACAATCAC -3'
(R):5'- AATGCCAGTTTCCCCTATACC -3'
Posted On2015-06-10