Incidental Mutation 'R4182:Dnajc21'
List |< first << previous [record 11 of 38] next >> last >|
ID319791
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene NameDnaJ heat shock protein family (Hsp40) member C21
Synonyms9930116P15Rik, 4930461P20Rik
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location10446756-10470516 bp(-) (GRCm38)
Type of Mutationsplice site (22 bp from exon)
DNA Base Change (assembly) T to C at 10459933 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591] [ENSMUST00000136591]
Predicted Effect probably null
Transcript: ENSMUST00000136591
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136591
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145719
SMART Domains Protein: ENSMUSP00000116192
Gene: ENSMUSG00000044224

DomainStartEndE-ValueType
coiled coil region 26 131 N/A INTRINSIC
ZnF_U1 160 194 5.3e-8 SMART
ZnF_C2H2 163 187 1.67e-2 SMART
low complexity region 228 242 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
ZnF_C2H2 332 356 5.34e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147224
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2421:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2422:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R4939:Dnajc21 UTSW 15 10449597 missense probably damaging 0.96
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5187:Dnajc21 UTSW 15 10463964 missense probably benign 0.21
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7016:Dnajc21 UTSW 15 10461407 nonsense probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATTAGAACTCCCAATTTCTAG -3'
(R):5'- TAGAGCTGTGCTTTCCAGTG -3'

Sequencing Primer
(F):5'- TCTAGTTCAGTCTAGAAAACAGGAC -3'
(R):5'- CCAGTGGGATTGAGACTCTGC -3'
Posted On2015-06-10