Incidental Mutation 'R4182:H2-T24'
List |< first << previous [record 15 of 38] next >> last >|
ID319792
Institutional Source Beutler Lab
Gene Symbol H2-T24
Ensembl Gene ENSMUSG00000053835
Gene Namehistocompatibility 2, T region locus 24
SynonymsH-2T24
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36005695-36020560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36015484 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 174 (N174K)
Ref Sequence ENSEMBL: ENSMUSP00000109389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113760] [ENSMUST00000174063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113760
AA Change: N174K

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109389
Gene: ENSMUSG00000053835
AA Change: N174K

DomainStartEndE-ValueType
Pfam:MHC_I 18 204 3.2e-46 PFAM
IGc1 223 294 2.61e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect probably benign
Transcript: ENSMUST00000174063
SMART Domains Protein: ENSMUSP00000133476
Gene: ENSMUSG00000053835

DomainStartEndE-ValueType
Pfam:MHC_I 18 114 1.3e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in H2-T24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:H2-T24 APN 17 36017236 splice site probably benign
IGL02268:H2-T24 APN 17 36017372 missense probably damaging 1.00
IGL02620:H2-T24 APN 17 36017291 missense probably damaging 1.00
IGL03192:H2-T24 APN 17 36015476 nonsense probably null
IGL03387:H2-T24 APN 17 36006779 missense unknown
R0131:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0131:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0132:H2-T24 UTSW 17 36014986 missense probably damaging 0.98
R0334:H2-T24 UTSW 17 36014880 missense possibly damaging 0.75
R0531:H2-T24 UTSW 17 36015571 missense probably benign
R0678:H2-T24 UTSW 17 36017441 missense probably damaging 1.00
R1161:H2-T24 UTSW 17 36014996 nonsense probably null
R1310:H2-T24 UTSW 17 36014996 nonsense probably null
R1726:H2-T24 UTSW 17 36015621 missense probably benign 0.01
R3891:H2-T24 UTSW 17 36015438 missense possibly damaging 0.59
R3948:H2-T24 UTSW 17 36017372 missense probably damaging 1.00
R4106:H2-T24 UTSW 17 36017478 missense possibly damaging 0.65
R4229:H2-T24 UTSW 17 36014829 missense probably benign 0.06
R5220:H2-T24 UTSW 17 36014670 missense probably benign 0.12
R6257:H2-T24 UTSW 17 36014682 missense probably benign 0.01
R7081:H2-T24 UTSW 17 36017452 missense probably damaging 0.97
R7543:H2-T24 UTSW 17 36014851 missense possibly damaging 0.70
R7739:H2-T24 UTSW 17 36014591 missense probably benign 0.33
R8323:H2-T24 UTSW 17 36017539 critical splice acceptor site probably null
R8358:H2-T24 UTSW 17 36017337 missense probably benign 0.32
V8831:H2-T24 UTSW 17 36017324 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCTACCAACTACAGAGTGAG -3'
(R):5'- CTGGGAAATACATCTGTGGGG -3'

Sequencing Primer
(F):5'- ACAGAGTGAGCTTTTACCCTG -3'
(R):5'- AAATACATCTGTGGGGTCACTG -3'
Posted On2015-06-10