Incidental Mutation 'R4182:Olfr97'
ID319793
Institutional Source Beutler Lab
Gene Symbol Olfr97
Ensembl Gene ENSMUSG00000058802
Gene Nameolfactory receptor 97
SynonymsMOR156-2, GA_x6K02T2PSCP-1672287-1671355
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37230963-37237330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37231848 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 174 (H174P)
Ref Sequence ENSEMBL: ENSMUSP00000151044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073667] [ENSMUST00000207414] [ENSMUST00000213328] [ENSMUST00000214622] [ENSMUST00000214848] [ENSMUST00000216225]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073667
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094937
Gene: ENSMUSG00000058802
AA Change: H174P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 305 4.5e-9 PFAM
Pfam:7tm_4 29 306 1.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.1e-5 PFAM
Pfam:7tm_1 39 288 8.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207414
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213328
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214622
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214848
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216225
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.3178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Olfr97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Olfr97 APN 17 37231548 missense probably damaging 1.00
IGL02424:Olfr97 APN 17 37232372 start gained probably benign
IGL03129:Olfr97 APN 17 37232196 missense probably damaging 1.00
R0619:Olfr97 UTSW 17 37232155 missense possibly damaging 0.92
R0811:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R0812:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R1122:Olfr97 UTSW 17 37232043 missense probably damaging 1.00
R1927:Olfr97 UTSW 17 37231543 missense probably damaging 1.00
R1997:Olfr97 UTSW 17 37231632 missense probably damaging 1.00
R3771:Olfr97 UTSW 17 37231465 missense possibly damaging 0.53
R3775:Olfr97 UTSW 17 37232230 missense probably damaging 0.98
R4183:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4184:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4198:Olfr97 UTSW 17 37232134 missense probably benign 0.01
R7453:Olfr97 UTSW 17 37231980 missense probably damaging 1.00
R7615:Olfr97 UTSW 17 37231450 missense probably benign 0.25
R7829:Olfr97 UTSW 17 37232310 missense probably benign 0.01
R8223:Olfr97 UTSW 17 37231836 missense possibly damaging 0.89
Z1177:Olfr97 UTSW 17 37232296 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAACTGCATGTAGCCAAG -3'
(R):5'- ACATGGATAACCTGCTTCTAGC -3'

Sequencing Primer
(F):5'- TTTCCTTTTTCCCTGTGCTGATGG -3'
(R):5'- AGCAGTCATGGCTATTGACC -3'
Posted On2015-06-10