Incidental Mutation 'R4182:Arhgap12'
List [record 1 of 38] next >> last >|
ID319795
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene NameRho GTPase activating protein 12
Synonyms2810011M08Rik
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4182 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6024427-6136098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6111734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 210 (D210G)
Ref Sequence ENSEMBL: ENSMUSP00000138585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182038] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
Predicted Effect probably damaging
Transcript: ENSMUST00000062584
AA Change: D210G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077128
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181989
Predicted Effect probably damaging
Transcript: ENSMUST00000182038
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138150
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182066
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182178
Predicted Effect probably damaging
Transcript: ENSMUST00000182213
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182383
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182559
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182614
Predicted Effect unknown
Transcript: ENSMUST00000182921
AA Change: D82G
Meta Mutation Damage Score 0.6614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Tmem115 A G 9: 107,535,283 T269A probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6057576 missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6061853 missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6027613 missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6111857 missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6031766 missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6111936 missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6061982 intron probably benign
R0330:Arhgap12 UTSW 18 6039382 missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6064433 intron probably benign
R0891:Arhgap12 UTSW 18 6026699 missense probably damaging 1.00
R1123:Arhgap12 UTSW 18 6031822 missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6037058 missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6112340 missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6037057 missense probably benign 0.36
R3824:Arhgap12 UTSW 18 6061930 missense possibly damaging 0.80
R4181:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6112170 nonsense probably null
R5539:Arhgap12 UTSW 18 6111932 missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6037016 critical splice donor site probably null
R6859:Arhgap12 UTSW 18 6111803 missense probably damaging 1.00
R6960:Arhgap12 UTSW 18 6111901 missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6028056 missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6111920 missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6065709 missense possibly damaging 0.92
R8048:Arhgap12 UTSW 18 6052883 missense probably benign 0.02
R8249:Arhgap12 UTSW 18 6027635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACTCTGTGTGTTCCGAAC -3'
(R):5'- ATGCCAATCAGAATTTCGGATCC -3'

Sequencing Primer
(F):5'- TGTTCCGAACACATAAAGCAAAAC -3'
(R):5'- CGGATCCAATTATAATTCAGGCCAG -3'
Posted On2015-06-10