Incidental Mutation 'R0395:Mast4'
ID31980
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 038601-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R0395 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102735273 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2529 (E2529G)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect probably damaging
Transcript: ENSMUST00000099202
AA Change: E2352G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: E2352G

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: E2529G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: E2529G

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: E2337G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: E2337G

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: E2361G
Meta Mutation Damage Score 0.3567 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Acsm2 G A 7: 119,575,746 D245N probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apba2 T A 7: 64,743,408 I547N probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Col16a1 G A 4: 130,073,109 G583D probably damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Per1 T A 11: 69,102,277 I340N probably damaging Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Slf1 A G 13: 77,105,969 probably benign Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAACCACGAAGTCTTTCTCTG -3'
(R):5'- GTATGAAAAGGTCACCCTCTGCCAC -3'

Sequencing Primer
(F):5'- GAGGGAGCGATCTGTGC -3'
(R):5'- CCCCAGAAAAGTCTCTGAGTTAC -3'
Posted On2013-04-24