Incidental Mutation 'R4183:Zfp982'
ID319812
Institutional Source Beutler Lab
Gene Symbol Zfp982
Ensembl Gene ENSMUSG00000078496
Gene Namezinc finger protein 982
SynonymsGm13152
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4183 (G1)
Quality Score114
Status Not validated
Chromosome4
Chromosomal Location147492417-147513486 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147512693 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 169 (K169R)
Ref Sequence ENSEMBL: ENSMUSP00000101346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063704] [ENSMUST00000105721]
Predicted Effect probably benign
Transcript: ENSMUST00000063704
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068021
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105721
AA Change: K169R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101346
Gene: ENSMUSG00000078496
AA Change: K169R

DomainStartEndE-ValueType
KRAB 13 72 6.26e-16 SMART
ZnF_C2H2 102 124 1.68e1 SMART
ZnF_C2H2 130 152 1.82e-3 SMART
ZnF_C2H2 158 180 7.55e-1 SMART
ZnF_C2H2 186 208 8.47e-4 SMART
ZnF_C2H2 214 236 1.28e-3 SMART
ZnF_C2H2 242 264 9.73e-4 SMART
ZnF_C2H2 270 292 4.94e-5 SMART
ZnF_C2H2 298 320 5.29e-5 SMART
ZnF_C2H2 326 348 2.43e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Other mutations in Zfp982
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Zfp982 APN 4 147512369 missense probably benign
IGL02989:Zfp982 APN 4 147512595 missense possibly damaging 0.47
R0035:Zfp982 UTSW 4 147512692 missense probably benign 0.00
R0123:Zfp982 UTSW 4 147512636 missense probably benign 0.04
R1502:Zfp982 UTSW 4 147512669 missense probably benign 0.00
R1982:Zfp982 UTSW 4 147512592 nonsense probably null
R4181:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4182:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4184:Zfp982 UTSW 4 147512693 missense probably benign 0.00
R4427:Zfp982 UTSW 4 147512623 nonsense probably null
R4814:Zfp982 UTSW 4 147512633 missense possibly damaging 0.58
R5697:Zfp982 UTSW 4 147512589 missense probably benign 0.02
R5777:Zfp982 UTSW 4 147510864 missense probably damaging 1.00
R7233:Zfp982 UTSW 4 147513261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTACATTGTCCATGAACACATG -3'
(R):5'- CCTGTATGAATTCTCTGATGATCAC -3'

Sequencing Primer
(F):5'- GGGACAAATGCTTTTCCCAAAG -3'
(R):5'- GAATTCTCTGATGATCACTAAGACTG -3'
Posted On2015-06-10