Incidental Mutation 'R4183:Grsf1'
ID319814
Institutional Source Beutler Lab
Gene Symbol Grsf1
Ensembl Gene ENSMUSG00000044221
Gene NameG-rich RNA sequence binding factor 1
SynonymsD5Wsu31e
MMRRC Submission 041019-MU
Accession Numbers

Genbank: NM_178700; MGI: 106479

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88659448-88676171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88664156 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 271 (P271S)
Ref Sequence ENSEMBL: ENSMUSP00000108860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078945] [ENSMUST00000113234] [ENSMUST00000153565]
Predicted Effect probably benign
Transcript: ENSMUST00000078945
AA Change: P388S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077972
Gene: ENSMUSG00000044221
AA Change: P388S

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 64 101 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RRM 150 224 1.65e-6 SMART
RRM 250 321 1.79e-11 SMART
RRM 401 471 1.54e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113234
AA Change: P271S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108860
Gene: ENSMUSG00000044221
AA Change: P271S

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
RRM 33 107 1.65e-6 SMART
RRM 133 204 1.79e-11 SMART
RRM 284 354 1.54e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130408
Predicted Effect probably benign
Transcript: ENSMUST00000153565
SMART Domains Protein: ENSMUSP00000123051
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
internal_repeat_1 2 33 5.45e-5 PROSPERO
RRM 52 123 1.79e-11 SMART
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cellular protein that binds RNAs containing the G-rich element. The protein is localized in the cytoplasm, and has been shown to stimulate translation of viral mRNAs in vitro. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Grsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Grsf1 APN 5 88670278 missense probably damaging 1.00
IGL01505:Grsf1 APN 5 88672749 nonsense probably null
IGL02108:Grsf1 APN 5 88665903 missense probably benign 0.35
IGL02116:Grsf1 APN 5 88670174 critical splice donor site probably null
IGL02713:Grsf1 APN 5 88672730 missense probably damaging 1.00
IGL02881:Grsf1 APN 5 88673830 missense probably damaging 1.00
R0336:Grsf1 UTSW 5 88663153 missense probably damaging 0.96
R1381:Grsf1 UTSW 5 88665864 missense probably benign 0.10
R1398:Grsf1 UTSW 5 88665847 missense probably benign 0.03
R2136:Grsf1 UTSW 5 88672658 missense probably benign 0.05
R2398:Grsf1 UTSW 5 88673836 missense probably damaging 1.00
R4181:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4182:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4184:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R5315:Grsf1 UTSW 5 88673775 start gained probably benign
R6246:Grsf1 UTSW 5 88662592 missense possibly damaging 0.81
R7359:Grsf1 UTSW 5 88665564 splice site probably null
R7381:Grsf1 UTSW 5 88665807 missense probably benign 0.02
R7430:Grsf1 UTSW 5 88663227 missense possibly damaging 0.67
R7703:Grsf1 UTSW 5 88671291 missense probably damaging 1.00
R7838:Grsf1 UTSW 5 88675664 start gained probably benign
R8013:Grsf1 UTSW 5 88675756 critical splice donor site probably null
YA93:Grsf1 UTSW 5 88673735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGTAGGCTTCAGCAAG -3'
(R):5'- TTCAGGTTTTGGCCTTTAAAGCC -3'

Sequencing Primer
(F):5'- GGAAATTGCAGAAACTGTTTCCC -3'
(R):5'- TTAAAGCCCATGCGCTCTGG -3'
Posted On2015-06-10