Incidental Mutation 'R4183:Tfpi2'
ID319815
Institutional Source Beutler Lab
Gene Symbol Tfpi2
Ensembl Gene ENSMUSG00000029664
Gene Nametissue factor pathway inhibitor 2
SynonymsPP5/TFPI-2
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location3962595-3988919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3963926 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 51 (V51L)
Ref Sequence ENSEMBL: ENSMUSP00000145193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031674] [ENSMUST00000183682] [ENSMUST00000203257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031674
AA Change: V169L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031674
Gene: ENSMUSG00000029664
AA Change: V169L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
KU 34 87 2.75e-26 SMART
KU 94 147 1.92e-2 SMART
KU 154 207 1.33e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183682
SMART Domains Protein: ENSMUSP00000139066
Gene: ENSMUSG00000029664

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
KU 30 83 2.75e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203257
AA Change: V51L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145193
Gene: ENSMUSG00000029664
AA Change: V51L

DomainStartEndE-ValueType
Blast:KU 1 29 3e-12 BLAST
KU 36 89 6.5e-22 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Tfpi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Tfpi2 APN 6 3965407 missense probably benign 0.17
IGL00721:Tfpi2 APN 6 3963414 missense probably benign 0.41
IGL01017:Tfpi2 APN 6 3965359 missense probably benign 0.00
R0391:Tfpi2 UTSW 6 3965460 missense probably benign
R1352:Tfpi2 UTSW 6 3968281 missense probably damaging 1.00
R1620:Tfpi2 UTSW 6 3965507 missense probably benign 0.17
R3441:Tfpi2 UTSW 6 3965504 missense probably benign 0.01
R4534:Tfpi2 UTSW 6 3968044 missense possibly damaging 0.87
R4535:Tfpi2 UTSW 6 3968044 missense possibly damaging 0.87
R4536:Tfpi2 UTSW 6 3968044 missense possibly damaging 0.87
R7048:Tfpi2 UTSW 6 3968032 missense probably damaging 1.00
R7870:Tfpi2 UTSW 6 3968281 missense probably damaging 1.00
R8116:Tfpi2 UTSW 6 3963872 missense probably damaging 0.99
R8379:Tfpi2 UTSW 6 3963849 missense probably damaging 1.00
Z1177:Tfpi2 UTSW 6 3974633 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAGAATGCTGTATTTGACTTTGGAGC -3'
(R):5'- GTCCCAGTGACTCGAGATAGAC -3'

Sequencing Primer
(F):5'- GCTGTATTTGACTTTGGAGCTATTC -3'
(R):5'- GACTCGAGATAGACCTGTTTTGAATG -3'
Posted On2015-06-10