Incidental Mutation 'R4183:Me3'
ID319817
Institutional Source Beutler Lab
Gene Symbol Me3
Ensembl Gene ENSMUSG00000030621
Gene Namemalic enzyme 3, NADP(+)-dependent, mitochondrial
Synonyms
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89632392-89854359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89851830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000032856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032856]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032853
SMART Domains Protein: ENSMUSP00000032853
Gene: ENSMUSG00000030621

DomainStartEndE-ValueType
Pfam:malic 1 26 7.5e-7 PFAM
Malic_M 36 288 5.68e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032856
AA Change: D583G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032856
Gene: ENSMUSG00000030621
AA Change: D583G

DomainStartEndE-ValueType
malic 114 295 4.77e-105 SMART
Malic_M 305 557 5.68e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159167
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Malic enzyme catalyzes the oxidative decarboxylation of malate to pyruvate using either NAD+ or NADP+ as a cofactor. Mammalian tissues contain 3 distinct isoforms of malic enzyme: a cytosolic NADP(+)-dependent isoform, a mitochondrial NADP(+)-dependent isoform, and a mitochondrial NAD(+)-dependent isoform. This gene encodes a mitochondrial NADP(+)-dependent isoform. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Me3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Me3 APN 7 89849636 missense probably damaging 0.99
IGL01965:Me3 APN 7 89851743 missense probably benign 0.03
IGL02657:Me3 APN 7 89846253 missense probably benign 0.01
R0035:Me3 UTSW 7 89851759 missense probably benign 0.01
R0144:Me3 UTSW 7 89739872 missense probably damaging 0.98
R0206:Me3 UTSW 7 89849660 missense probably benign
R0206:Me3 UTSW 7 89849660 missense probably benign
R0360:Me3 UTSW 7 89786414 splice site probably null
R1501:Me3 UTSW 7 89633065 missense probably benign 0.01
R1579:Me3 UTSW 7 89845842 missense possibly damaging 0.53
R1613:Me3 UTSW 7 89786420 splice site probably benign
R1741:Me3 UTSW 7 89851833 missense probably damaging 1.00
R1757:Me3 UTSW 7 89633022 missense probably benign
R2177:Me3 UTSW 7 89633070 missense probably benign 0.16
R2202:Me3 UTSW 7 89850381 missense probably damaging 0.98
R3841:Me3 UTSW 7 89786493 missense possibly damaging 0.73
R3928:Me3 UTSW 7 89833690 splice site probably benign
R4274:Me3 UTSW 7 89806726 missense probably damaging 0.98
R4476:Me3 UTSW 7 89739860 missense probably damaging 1.00
R4532:Me3 UTSW 7 89632900 start gained probably benign
R4560:Me3 UTSW 7 89849730 missense probably benign 0.32
R4947:Me3 UTSW 7 89633014 missense probably benign
R5511:Me3 UTSW 7 89806668 missense probably damaging 1.00
R5622:Me3 UTSW 7 89796663 missense probably damaging 1.00
R5878:Me3 UTSW 7 89848006 missense probably benign 0.01
R6139:Me3 UTSW 7 89632900 start gained probably benign
R6265:Me3 UTSW 7 89849743 missense probably benign 0.00
R6923:Me3 UTSW 7 89845885 missense probably damaging 1.00
R7419:Me3 UTSW 7 89736719 missense probably damaging 1.00
R7516:Me3 UTSW 7 89847975 nonsense probably null
R8390:Me3 UTSW 7 89849595 missense probably damaging 1.00
R8434:Me3 UTSW 7 89739878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATACTCCTTAGCCCCTGG -3'
(R):5'- CAGGAACAAAGCTATCATCGCTG -3'

Sequencing Primer
(F):5'- GCTGCCAAGTAAGGAGCCTTTAAG -3'
(R):5'- GAACAAAGCTATCATCGCTGTTTGC -3'
Posted On2015-06-10