Incidental Mutation 'R4183:Gprc5b'
ID319819
Institutional Source Beutler Lab
Gene Symbol Gprc5b
Ensembl Gene ENSMUSG00000008734
Gene NameG protein-coupled receptor, family C, group 5, member B
Synonymshypothetical protein, clone 2-63
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118972047-118995211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118984526 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 40 (D40G)
Ref Sequence ENSEMBL: ENSMUSP00000146777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]
Predicted Effect probably benign
Transcript: ENSMUST00000008878
AA Change: D40G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: D40G

DomainStartEndE-ValueType
Pfam:7tm_3 67 294 2e-33 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208394
AA Change: D40G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Gprc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Gprc5b APN 7 118983861 missense probably benign
IGL01687:Gprc5b APN 7 118983986 missense possibly damaging 0.67
IGL02937:Gprc5b APN 7 118983794 missense probably benign 0.36
IGL03088:Gprc5b APN 7 118983633 missense probably benign 0.08
IGL03106:Gprc5b APN 7 118984193 missense probably damaging 1.00
IGL03166:Gprc5b APN 7 118983999 missense probably benign 0.20
R0189:Gprc5b UTSW 7 118983633 missense probably benign 0.08
R0588:Gprc5b UTSW 7 118983995 missense probably benign
R1563:Gprc5b UTSW 7 118983761 missense probably benign 0.22
R2126:Gprc5b UTSW 7 118984175 missense probably damaging 1.00
R2842:Gprc5b UTSW 7 118984079 missense possibly damaging 0.93
R3153:Gprc5b UTSW 7 118976547 missense probably damaging 1.00
R3802:Gprc5b UTSW 7 118983720 missense possibly damaging 0.92
R3978:Gprc5b UTSW 7 118984131 missense probably damaging 1.00
R4007:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4297:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4298:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4299:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R5286:Gprc5b UTSW 7 118983687 missense possibly damaging 0.93
R6492:Gprc5b UTSW 7 118984577 missense possibly damaging 0.68
R6606:Gprc5b UTSW 7 118984073 missense probably benign 0.00
R7085:Gprc5b UTSW 7 118983632 missense probably damaging 0.97
R7312:Gprc5b UTSW 7 118984259 missense probably damaging 1.00
R7593:Gprc5b UTSW 7 118984269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTGTCTCGTCCATCTGG -3'
(R):5'- GGGCCTTACAACGAACTGAG -3'

Sequencing Primer
(F):5'- TCTGGATGATGAAGGCAAACGTC -3'
(R):5'- GGCCTTACAACGAACTGAGCTTTC -3'
Posted On2015-06-10