Incidental Mutation 'R4183:Pcsk4'
ID319828
Institutional Source Beutler Lab
Gene Symbol Pcsk4
Ensembl Gene ENSMUSG00000020131
Gene Nameproprotein convertase subtilisin/kexin type 4
SynonymsPC4, SPC5
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80321283-80329498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80325011 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 327 (R327Q)
Ref Sequence ENSEMBL: ENSMUSP00000020340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000020341] [ENSMUST00000105354] [ENSMUST00000105355] [ENSMUST00000105357] [ENSMUST00000105358] [ENSMUST00000128653] [ENSMUST00000135071]
Predicted Effect probably benign
Transcript: ENSMUST00000020340
AA Change: R327Q

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131
AA Change: R327Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105354
SMART Domains Protein: ENSMUSP00000100991
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105355
SMART Domains Protein: ENSMUSP00000100992
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 3.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105357
SMART Domains Protein: ENSMUSP00000100994
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 297 319 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
low complexity region 411 428 N/A INTRINSIC
SCOP:d1gkub1 434 465 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105358
SMART Domains Protein: ENSMUSP00000100995
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
SCOP:d1gkub1 461 492 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130521
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147132
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
PHENOTYPE: Inactivation of this locus results in significantly reduced male fertility, putatively due to impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Pcsk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pcsk4 APN 10 80322823 missense probably damaging 1.00
IGL02818:Pcsk4 APN 10 80322792 missense probably damaging 0.98
IGL03115:Pcsk4 APN 10 80329049 missense probably damaging 1.00
IGL03354:Pcsk4 APN 10 80326059 missense probably damaging 0.99
R0538:Pcsk4 UTSW 10 80325334 missense probably damaging 1.00
R0760:Pcsk4 UTSW 10 80325941 unclassified probably benign
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1554:Pcsk4 UTSW 10 80321951 missense probably benign 0.01
R1728:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1784:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1886:Pcsk4 UTSW 10 80328960 missense probably benign 0.32
R1981:Pcsk4 UTSW 10 80325779 missense probably damaging 1.00
R2090:Pcsk4 UTSW 10 80325821 missense probably benign 0.02
R2125:Pcsk4 UTSW 10 80323879 missense probably benign 0.32
R2283:Pcsk4 UTSW 10 80322750 missense probably damaging 1.00
R4283:Pcsk4 UTSW 10 80329453 unclassified probably benign
R4798:Pcsk4 UTSW 10 80323104 missense probably damaging 1.00
R4857:Pcsk4 UTSW 10 80325039 missense probably damaging 1.00
R4990:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R4991:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R5020:Pcsk4 UTSW 10 80326035 missense probably benign 0.00
R5123:Pcsk4 UTSW 10 80322145 missense probably null 0.56
R5354:Pcsk4 UTSW 10 80323689 missense probably damaging 0.98
R6077:Pcsk4 UTSW 10 80326239 missense probably damaging 0.99
R6102:Pcsk4 UTSW 10 80325817 nonsense probably null
R6250:Pcsk4 UTSW 10 80325592 missense probably benign 0.04
R6378:Pcsk4 UTSW 10 80328975 missense probably benign 0.34
R6729:Pcsk4 UTSW 10 80325101 missense probably damaging 0.99
R7308:Pcsk4 UTSW 10 80323173 missense probably benign 0.41
R7595:Pcsk4 UTSW 10 80322101 missense possibly damaging 0.84
R8004:Pcsk4 UTSW 10 80322840 missense probably damaging 1.00
Z1176:Pcsk4 UTSW 10 80322726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTCAGAGAGCCTCCATGTG -3'
(R):5'- ACTGACTCTGTTCTCTCGGG -3'

Sequencing Primer
(F):5'- TGGCACAGATCTTGCCCGAG -3'
(R):5'- TCGGGTCACACTCCACC -3'
Posted On2015-06-10