Incidental Mutation 'R4183:Inpp5j'
ID319829
Institutional Source Beutler Lab
Gene Symbol Inpp5j
Ensembl Gene ENSMUSG00000034570
Gene Nameinositol polyphosphate 5-phosphatase J
SynonymsPipp, Pib5pa
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3494375-3504821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3501134 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 505 (I505T)
Ref Sequence ENSEMBL: ENSMUSP00000139302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044507] [ENSMUST00000044682] [ENSMUST00000110018] [ENSMUST00000110019] [ENSMUST00000154756] [ENSMUST00000183684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044507
AA Change: I505T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046625
Gene: ENSMUSG00000034570
AA Change: I505T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 840 862 N/A INTRINSIC
low complexity region 868 887 N/A INTRINSIC
low complexity region 898 919 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 992 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044682
SMART Domains Protein: ENSMUSP00000041571
Gene: ENSMUSG00000034579

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PA2c 139 259 1.58e-2 SMART
low complexity region 305 324 N/A INTRINSIC
Pfam:Phospholip_A2_2 343 431 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110018
SMART Domains Protein: ENSMUSP00000105645
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110019
SMART Domains Protein: ENSMUSP00000105646
Gene: ENSMUSG00000034570

DomainStartEndE-ValueType
IPPc 2 301 4e-86 SMART
low complexity region 408 430 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
low complexity region 466 487 N/A INTRINSIC
low complexity region 492 511 N/A INTRINSIC
low complexity region 560 570 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148939
AA Change: I133T
Predicted Effect probably damaging
Transcript: ENSMUST00000154756
AA Change: I505T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139302
Gene: ENSMUSG00000034570
AA Change: I505T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 180 216 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 333 365 N/A INTRINSIC
low complexity region 390 413 N/A INTRINSIC
IPPc 418 733 4.41e-98 SMART
low complexity region 870 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183684
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show normal mammary gland development and no spontaneous mammary tumors. However, in an oncogene-driven breast cancer mouse model, mice show increased mammary hyperplasia and tumor growth paradoxically associated with reduced lung metastases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Inpp5j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Inpp5j APN 11 3500009 splice site probably benign
IGL00435:Inpp5j APN 11 3502255 missense probably benign 0.00
IGL00509:Inpp5j APN 11 3501595 missense possibly damaging 0.94
IGL00916:Inpp5j APN 11 3502389 missense probably damaging 1.00
IGL00975:Inpp5j APN 11 3502176 missense probably damaging 1.00
IGL01523:Inpp5j APN 11 3495932 splice site probably null
IGL02472:Inpp5j APN 11 3495338 unclassified probably benign
IGL02512:Inpp5j APN 11 3499661 missense probably damaging 1.00
IGL02897:Inpp5j APN 11 3500619 missense probably damaging 1.00
IGL03408:Inpp5j APN 11 3502809 missense possibly damaging 0.95
R0048:Inpp5j UTSW 11 3501417 missense probably damaging 0.97
R0440:Inpp5j UTSW 11 3501150 missense possibly damaging 0.95
R0455:Inpp5j UTSW 11 3503122 missense possibly damaging 0.66
R0483:Inpp5j UTSW 11 3499738 missense probably damaging 1.00
R0554:Inpp5j UTSW 11 3499644 missense probably damaging 1.00
R0639:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0673:Inpp5j UTSW 11 3501147 missense probably benign 0.29
R0926:Inpp5j UTSW 11 3501439 splice site probably benign
R1114:Inpp5j UTSW 11 3494814 missense possibly damaging 0.57
R1132:Inpp5j UTSW 11 3502305 missense possibly damaging 0.90
R1463:Inpp5j UTSW 11 3501147 missense probably benign 0.03
R1757:Inpp5j UTSW 11 3504738 missense possibly damaging 0.49
R1978:Inpp5j UTSW 11 3502150 missense probably damaging 1.00
R3078:Inpp5j UTSW 11 3503124 splice site probably null
R3831:Inpp5j UTSW 11 3500229 missense probably damaging 1.00
R4012:Inpp5j UTSW 11 3500185 missense probably benign 0.06
R4209:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4210:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4211:Inpp5j UTSW 11 3501107 missense probably damaging 1.00
R4477:Inpp5j UTSW 11 3501625 missense probably damaging 1.00
R4729:Inpp5j UTSW 11 3495025 missense probably damaging 0.99
R4840:Inpp5j UTSW 11 3499676 missense probably damaging 1.00
R5025:Inpp5j UTSW 11 3500664 missense probably damaging 1.00
R5151:Inpp5j UTSW 11 3502270 missense probably damaging 1.00
R5195:Inpp5j UTSW 11 3499889 critical splice donor site probably null
R5623:Inpp5j UTSW 11 3494766 missense probably damaging 0.96
R6262:Inpp5j UTSW 11 3502615 missense probably benign 0.02
R6448:Inpp5j UTSW 11 3495387 missense probably damaging 0.99
R6465:Inpp5j UTSW 11 3502293 missense possibly damaging 0.84
R6723:Inpp5j UTSW 11 3500640 missense probably damaging 0.99
R6895:Inpp5j UTSW 11 3495557 splice site probably null
R7060:Inpp5j UTSW 11 3500133 splice site probably null
R7346:Inpp5j UTSW 11 3501065 missense probably damaging 1.00
R8026:Inpp5j UTSW 11 3495171 missense
R8360:Inpp5j UTSW 11 3499767 missense probably damaging 0.99
T0975:Inpp5j UTSW 11 3502527 missense possibly damaging 0.69
Z1176:Inpp5j UTSW 11 3502484 nonsense probably null
Z1177:Inpp5j UTSW 11 3502191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCAGGATGAGTTCTAAGG -3'
(R):5'- ACACCCTTGTGAGAAGCAGG -3'

Sequencing Primer
(F):5'- CGTAGAAATGGATGGTGCTTG -3'
(R):5'- AAGCAGGAGCCCTTCTGGATTC -3'
Posted On2015-06-10