Incidental Mutation 'R4183:Chrnb1'
ID319831
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Namecholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
SynonymsAChR beta, Acrb, Achr-2
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R4183 (G1)
Quality Score176
Status Not validated
Chromosome11
Chromosomal Location69784036-69795943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69787096 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 277 (M277V)
Ref Sequence ENSEMBL: ENSMUSP00000047270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045971] [ENSMUST00000108639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045971
AA Change: M277V

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189
AA Change: M277V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108639
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69793916 missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69795019 unclassified probably benign
IGL01983:Chrnb1 APN 11 69795729 missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69793455 unclassified probably benign
IGL02507:Chrnb1 APN 11 69785090 missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69795680 missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69785109 missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69784757 missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69785762 missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69793584 missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69792737 missense possibly damaging 0.81
R2233:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R2234:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69792916 unclassified probably benign
R4425:Chrnb1 UTSW 11 69786947 missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69795675 missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69793978 missense probably damaging 1.00
R5000:Chrnb1 UTSW 11 69787032 missense probably damaging 0.96
R5378:Chrnb1 UTSW 11 69785181 missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69794153 missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69795650 missense probably benign 0.30
R5574:Chrnb1 UTSW 11 69793683 unclassified probably benign
R5890:Chrnb1 UTSW 11 69792729 missense possibly damaging 0.94
R5973:Chrnb1 UTSW 11 69795845 unclassified probably benign
R6056:Chrnb1 UTSW 11 69786939 missense probably damaging 1.00
R7466:Chrnb1 UTSW 11 69784650 missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69792873 missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69787024 missense possibly damaging 0.80
R8266:Chrnb1 UTSW 11 69784621 makesense probably null
Z1177:Chrnb1 UTSW 11 69794189 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGATGATGCAGGTTGAGGAC -3'
(R):5'- CCTTCTGGTAAAGACGAATCCTTC -3'

Sequencing Primer
(F):5'- TTGAGGACCACAACACTAAGG -3'
(R):5'- AAGACGAATCCTTCTTAGTGGTGTC -3'
Posted On2015-06-10