Incidental Mutation 'R4183:Degs2'
ID319833
Institutional Source Beutler Lab
Gene Symbol Degs2
Ensembl Gene ENSMUSG00000021263
Gene Namedelta(4)-desaturase, sphingolipid 2
SynonymsDes2, 2210008A03Rik
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108678711-108702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108692099 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 207 (K207R)
Ref Sequence ENSEMBL: ENSMUSP00000125891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000021691] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000167978] [ENSMUST00000172409]
Predicted Effect probably benign
Transcript: ENSMUST00000021689
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021691
AA Change: K207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021691
Gene: ENSMUSG00000021263
AA Change: K207R

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 65 294 3.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077735
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109854
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167978
AA Change: K207R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125891
Gene: ENSMUSG00000021263
AA Change: K207R

DomainStartEndE-ValueType
Lipid_DES 5 43 5.57e-18 SMART
Pfam:FA_desaturase 64 275 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172409
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222048
Predicted Effect unknown
Transcript: ENSMUST00000222255
AA Change: K28R
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Degs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02407:Degs2 APN 12 108691995 missense probably damaging 1.00
IGL02755:Degs2 APN 12 108692583 missense probably benign
largo UTSW 12 108692154 missense probably damaging 1.00
R0039:Degs2 UTSW 12 108690589 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0044:Degs2 UTSW 12 108692154 missense probably damaging 1.00
R0441:Degs2 UTSW 12 108702214 missense probably damaging 0.97
R1642:Degs2 UTSW 12 108692192 missense probably benign
R4817:Degs2 UTSW 12 108689066 nonsense probably null
R6268:Degs2 UTSW 12 108692580 missense probably damaging 1.00
R6863:Degs2 UTSW 12 108702202 missense probably damaging 1.00
R7626:Degs2 UTSW 12 108692073 missense possibly damaging 0.68
R7839:Degs2 UTSW 12 108692201 frame shift probably null
Z1177:Degs2 UTSW 12 108692597 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTTACCAGTGGCAGGTAGTAAC -3'
(R):5'- TATTCCTACGAACTTCGAGGGC -3'

Sequencing Primer
(F):5'- CCGGGGATACTGGGGAAGTC -3'
(R):5'- ACGAACTTCGAGGGCTGGTTC -3'
Posted On2015-06-10