Incidental Mutation 'R4183:Wdr25'
ID319834
Institutional Source Beutler Lab
Gene Symbol Wdr25
Ensembl Gene ENSMUSG00000040877
Gene NameWD repeat domain 25
Synonyms
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108893631-109028452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109027331 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 491 (F491Y)
Ref Sequence ENSEMBL: ENSMUSP00000129855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000167816] [ENSMUST00000190647] [ENSMUST00000209829] [ENSMUST00000221510]
Predicted Effect probably benign
Transcript: ENSMUST00000047115
AA Change: F491Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877
AA Change: F491Y

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167816
AA Change: F491Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877
AA Change: F491Y

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190647
SMART Domains Protein: ENSMUSP00000140393
Gene: ENSMUSG00000040867

DomainStartEndE-ValueType
SCOP:d1fxkc_ 18 132 2e-4 SMART
low complexity region 285 306 N/A INTRINSIC
low complexity region 309 326 N/A INTRINSIC
low complexity region 445 460 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209829
Predicted Effect probably benign
Transcript: ENSMUST00000221510
AA Change: F139Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Wdr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Wdr25 APN 12 109025027 missense possibly damaging 0.89
IGL02479:Wdr25 APN 12 108898601 missense probably benign
IGL02672:Wdr25 APN 12 108898081 nonsense probably null
IGL03329:Wdr25 APN 12 108898336 missense probably benign
R1061:Wdr25 UTSW 12 108992799 splice site probably null
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1582:Wdr25 UTSW 12 108898054 missense possibly damaging 0.94
R1764:Wdr25 UTSW 12 109026438 nonsense probably null
R1954:Wdr25 UTSW 12 108898541 missense probably damaging 0.99
R2258:Wdr25 UTSW 12 108898174 missense possibly damaging 0.94
R3770:Wdr25 UTSW 12 108898420 missense probably damaging 0.97
R3803:Wdr25 UTSW 12 108898553 missense probably damaging 1.00
R3948:Wdr25 UTSW 12 109027282 missense probably benign 0.02
R5246:Wdr25 UTSW 12 109027456 missense probably benign 0.06
R5290:Wdr25 UTSW 12 108898042 missense probably benign 0.26
R5305:Wdr25 UTSW 12 109026440 missense probably damaging 1.00
R5813:Wdr25 UTSW 12 109027421 missense possibly damaging 0.47
R5942:Wdr25 UTSW 12 108898466 missense probably benign 0.00
R6386:Wdr25 UTSW 12 109025065 missense probably damaging 1.00
R7171:Wdr25 UTSW 12 109024996 missense probably damaging 0.98
R7449:Wdr25 UTSW 12 109026441 missense probably damaging 1.00
R7616:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7617:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7619:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7622:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7623:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R8504:Wdr25 UTSW 12 109026467 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCAGGGTCACTAAAGATAAAGCC -3'
(R):5'- ATAGCCGAGTCACTGAAGCC -3'

Sequencing Primer
(F):5'- GTCACTAAAGATAAAGCCAGCCCTG -3'
(R):5'- GAGTCACTGAAGCCCAGCAG -3'
Posted On2015-06-10