Incidental Mutation 'R4183:Vmn1r201'
ID319835
Institutional Source Beutler Lab
Gene Symbol Vmn1r201
Ensembl Gene ENSMUSG00000094898
Gene Namevomeronasal 1 receptor 201
SynonymsV1ri4
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22471923-22478701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22474852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 79 (I79V)
Ref Sequence ENSEMBL: ENSMUSP00000154790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091730] [ENSMUST00000226330] [ENSMUST00000226965]
Predicted Effect probably benign
Transcript: ENSMUST00000091730
AA Change: I79V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089324
Gene: ENSMUSG00000094898
AA Change: I79V

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 2.4e-9 PFAM
Pfam:V1R 35 299 1.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226330
AA Change: I79V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226965
AA Change: I79V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Vmn1r201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Vmn1r201 APN 13 22474844 missense probably damaging 0.97
IGL03137:Vmn1r201 APN 13 22474804 missense probably benign 0.01
R0278:Vmn1r201 UTSW 13 22475024 missense probably damaging 1.00
R0381:Vmn1r201 UTSW 13 22475023 missense probably damaging 1.00
R0544:Vmn1r201 UTSW 13 22475146 missense probably benign 0.04
R1411:Vmn1r201 UTSW 13 22474679 missense probably benign 0.01
R1544:Vmn1r201 UTSW 13 22474798 missense probably benign 0.20
R1850:Vmn1r201 UTSW 13 22474631 missense probably benign 0.08
R1891:Vmn1r201 UTSW 13 22475255 missense probably benign 0.01
R2071:Vmn1r201 UTSW 13 22474825 missense probably benign 0.34
R4924:Vmn1r201 UTSW 13 22474712 missense probably benign 0.00
R4989:Vmn1r201 UTSW 13 22475452 missense possibly damaging 0.95
R5028:Vmn1r201 UTSW 13 22475360 nonsense probably null
R5318:Vmn1r201 UTSW 13 22474922 missense probably damaging 1.00
R5369:Vmn1r201 UTSW 13 22475502 missense probably benign 0.00
R5682:Vmn1r201 UTSW 13 22475185 missense probably damaging 0.99
R5699:Vmn1r201 UTSW 13 22475239 missense probably damaging 1.00
R6180:Vmn1r201 UTSW 13 22475329 missense possibly damaging 0.94
R6273:Vmn1r201 UTSW 13 22475215 missense probably damaging 1.00
R6295:Vmn1r201 UTSW 13 22475363 missense probably benign 0.00
R6331:Vmn1r201 UTSW 13 22475351 missense probably damaging 1.00
R7296:Vmn1r201 UTSW 13 22475339 missense possibly damaging 0.69
R7758:Vmn1r201 UTSW 13 22474819 missense not run
R7832:Vmn1r201 UTSW 13 22475368 missense possibly damaging 0.76
R7887:Vmn1r201 UTSW 13 22474786 missense probably damaging 0.99
R7976:Vmn1r201 UTSW 13 22474705 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TCTCTAGCTGGACCTGGAATTG -3'
(R):5'- GCAAGTTGGAGCTTATGAGAAC -3'

Sequencing Primer
(F):5'- GGACCTGGAATTGTAGGAAATATTC -3'
(R):5'- GGAGCTTATGAGAACATTAACAATCC -3'
Posted On2015-06-10